References

Johnson, C. (2016, March 3). Socio-economic and Environmental Impact of Homelessness in Olympia,

Washington. Pierce County. Retrieved March 29, 2022, from

https://www.piercecountywa.gov/DocumentCenter/View/44599/Impacts-of-Homelessness-in-Oly

mpia

Ponio, J. (2021, June 27). How Homelessness Affects Society. Our Father’s House Soup Kitchen.

Retrieved March 29, 2022, from https://ofhsoupkitchen.org/how-homelessness-affects-society

von Wurden, C. J., & Withrow, A. (2018, May 1). The Impact of Homelessness on Economic

Competitiveness | ASP American Security Project. American Security Project. Retrieved March

29, 2022, from

The Impact of Homelessness on Economic Competitiveness

Research paper title: The significance of the social and economic
environment in Edith Wharton’s Ethan Frome.
Requirements

Paper must be 10-15 pages long, double-spaced, in size 12, Times
New Roman font. (NOT including bibliography and title page!).

● Paper must have the ENTIRE essay title/question written at the
top.

● Paper must have your name at the top.
● Paper must contain plenty of quotations from the Primary material

you are working with (‘Ethan Frome’).
● Paper must contain TWO quotations from two DIFFERENT

SECONDARY SOURCES. This could include biographies on the
authors, or academic books and essays about their work.

● Paper must have a bibliography/works cited page at the back with
all the books, Primary and Secondary, that you have used, properly
cited. You do NOT need your annotations underneath the citations
anymore, so don’t forget to delete them!

● Don’t forget to do in-text citations for all sources within the paper
(author’s last name and the page number). Use the MLA style.

Things to AVOID:

● General introductions about life and the world we live in that don’t
immediately reference the literature under discussion.

● Informal or chatty language.
● Contractions (i.e don’t, can’t, they’re etc).
● Avoid narrating the story! Analyze ideas and quotations instead.
● Try to avoid the 1st person.

● Try to avoid passing judgment on the characters. Maintain an aloof
and academic tone.

Today, more and more colleges and universities are offering not only individual courses but entire degree programs online. Some educators worry that online programs do not provide the same quality as an on-campus education and that in an online program, students can get others to do their work. Others believe online courses offer convenience and flexibility enabling students, who might otherwise not be able, to earn a degree and complete their educations. Should colleges and universities offer degrees entirely online? Conduct research to find evidence to support a thesis statement defending the chosen stance on the issue.

MLA documentation is required.

Five paragraph  3-5 pages

MY POINT OF VIEW: Colleges and universities should not offer degrees entirely online.

Discussion Question: Discuss the Introduction, Description of the Problem or Issue, and Analysis of the Academic Article Critique Assignment for the selected topic for the Week 2 Assignment. The purpose of this assignment is to review and provide feedback to your peers prior to the final submission of the Week 2 Academic Article Critique. You will post your work in the text box (not as an attachment). In following with APA 7th Edition guidelines, make sure to have in-text citations and list your references beneath your work. 

  1. Title Page
  2. Introduction (125 words)
  3. Description of the Problem or Issue (125 words)
  4. Analysis (500 words)

Due: April 30th, 2022.


Assignment:

required to research and compare and contrast the incidence of human trafficking in any two countries around the world. You are also at liberty to select more than two countries for your analyses and comparison. In your essay, provide a detailed but relevant information about your selected countries. Such relevant information may include, but not limited to location, population size, economic conditions, and cultural practices that aid or prevent contemporary slavery and human trafficking. You will need to discuss the countries’ strategies and policies to combat human trafficking in persons, any challenges they may have encountered, and how impactful such strategies have been. As a scholar of trafficking in persons, you are expected to critique or identify the weaknesses in their strategies and to recommend ways to ensure effective approaches to trafficking in persons.


5pages


4 Sources

ENC 1102, 3/28/22

Prof. Scarpati

Second Research Paper, due Wednesday, April 27, 2022

St. Thomas University, Miami Gardens, FL

Research Paper

Your second research paper, 7 – 10 pages in length with a bibliography and citations (follow the MLA for pagination purposes), will be due Wednesday, April 27, 2022, a week prior to our last class and final exam date of Wednesday, May 4, 2022. This paper must be on another topic and different literature than the focus of your first research paper. Your analysis of the literature studied in class either from the time leading up to the mid-term exam or afterward must reach at least seven pages, as the bibliography—titled References—should not be considered when page length is provided. Follow the examples in the MLA style sheet that are presented in the text or access the Modern Language Association’s style sheet on the net or in the stacks in the library, to paginate your secondary sources that bolster and support your thesis statement. I suggest emailing me your thesis statement before beginning.

Process

This is just a suggestion as writing is an individual thing, but we will cover the process of analyzing literature in class several times by first writing an outline, in order to find major topics for development, to include material to be covered in different paragraphs, and to arrive at a thesis statement. The best way to approach this outline is first to determine the literature that you would like to consider for development. Don’t spend too much time with regard to this assessment; just go with your feelings following a first or second read of the short story of your choice. You may want to include more than one story for development of your thesis statement, but you certainly don’t have to do this. The way that I approach the outline is to randomly write my assessments of what I believe to be major areas for development by the author. You can include specific parts of the story for inclusion in these major areas, or you may want to include these areas in a separate process where notes on the primary story take place. Either way the idea is to present a major idea for development in a topic sentence with specific details concerning information presented by the author in the story included to round out the examples you present in your paragraphs. That is the essence of good writing, broad general ideas presented in your topic sentences with four to six sentences provided as examples supporting these topic sentences in the rest of the paragraph. Focus on the thesis statement should be your number one concern. Consider utilizing transitions leading your reader from one sentence to the following one and from one paragraph to the next.

References

It is not imperative to research many secondary sources to bolster your thesis. But it is wise to take notes based on your secondary research of outside sources and how these writers analyze the story under consideration and how these assessments apply to your thesis statement. Instead of quoting directly from these sources, it is suggested you provide your assessments of these writers’ analysis, by incorporating a synthesis of assessing why their words make sense to support your thesis. Using wording such as “According to” when introducing outside secondary sources and then naming the author’s last name and then proceeding with your take on why the information makes sense in the course of your development of the thesis is highly suggested. When you use direct quotes, the effect is jarring because the professional writer will certainly have a greater grasp of the language than you do. Also, using many direct quotes leads me to believe that you are desperate to reach the minimum length. Just believe in your own assessments and analysis of the literature, and you will most likely be in better shape than to place too much emphasis on published assessments of the literature.

Proofing

Give yourself a couple of days before finalizing the editing of your work. The best scenario is to finish the paper and then return to it in a day or two, to begin the proofreading process. Pay attention to grammar and the notion of providing variety with respect to sentence structure throughout your essay. Subject-verb agreement should also be strongly considered, as should run-on constructions (avoid) and fragments (also avoid).

Good Luck

It is highly suggested to send me your thesis statement before beginning your research and writing. A quick email to my stu email address would suffice, and this way I can assess if your statement is argumentative and says something of substance before you begin. I can make suggestions to improve your thesis, if applicable.

i
Mass Media Law
20th Edition
Clay Calvert
University of Florida
Dan V. Kozlowski
Saint Louis University
Derigan Silver
University of Denver
ii
MASS MEDIA LAW, TWENTIETH EDITION
Published by McGraw-Hill Education, 2 Penn Plaza, New York, NY 10121. Copyright © 2018 by McGraw-Hill Education. All rights reserved. Printed in the United States of America. Previous editions © 2015, 2013, and 2011. No part of this publication may be reproduced or distributed in any form or by any means, or stored in a database or retrieval system, without the prior written consent of McGraw-Hill Education, including, but not limited to, in any network or other electronic storage or transmission, or broadcast for distance learning.
Some ancillaries, including electronic and print components, may not be available to customers outside the United States.
This book is printed on acid-free paper.
1 2 3 4 5 6 7 8 9 LCR 21 20 19 18 17
ISBN 978-1-259-91390-7
MHID 1-259-91390-2
Portfolio Manager: Jamie Laferrera
Product Developer: Alexander Preiss
Senior Marketing Manager: Laura Young
Content Project Managers: Ryan Warczynski, Samantha Donisi-Hamm, Sandra Schnee
Senior Buyer: Sandy Ludovissy
Lead Content Licensing Specialist: Carrie Burger
Cover Image: ©wellphoto/Shutterstock RF
Compositor: MPS Limited
All credits appearing on page or at the end of the book are considered to be an extension of the copyright page.
The Internet addresses listed in the text were accurate at the time of publication. The inclusion of a Web site does not indicate an endorsement by the authors or McGraw-Hill Education, and McGraw-Hill Education does not guarantee the accuracy of the information presented at these sites.
iii
CONTENTS
The American Legal System
The First Amendment: The Meaning of Freedom
The First Amendment: Contemporary Problems
iv
Libel: Establishing a Case
Libel: Proof of Fault
v
Libel: Defenses and Damages
Invasion of Privacy: Appropriation and Intrusion
Invasion of Privacy: Publication of Private Information and False Light


Many research psychologists have research teams they work with and some members of the team end up on the publications while others do not. For two months during summer, Ann conducted research as an undergraduate student at a well-known university. She spent long hours in the laboratory injecting mice with opiate blockers to look at pain tolerance. She was responsible for shocking them, as a test for pain tolerance, and euthanizing them at the end of the study. When the article was published months later, Ann was surprised to find her name was only included in a note of thanks. What do you think about this situation?

· Did Ann have a right to be upset, or should she have been grateful for the opportunity? Why?

· Do you think a psychology professor who has published a number of scientific articles is more knowledgeable about the field of psychology as compared to a professor who has not published? Why?

·  Online Library to investigate the significance of the sequence in which authors’ names appear on a paper. Discuss your findings.

· Given that research involves teamwork, do you think that the hierarchical implications of this sequence are appropriate?

1 | P a g e

1 | P a g e

1 | P a g e


GENDER INEQUALITY IN HOSPITALITY INDUSTRY

Submitted on:

Monday, 26 July 2021

By: XXXXXXXXXXXXX Word count:

1190

Submitted to:

Contents
Introduction 3
Impact of geographical location on gender equality 3
Factor influencing gender inequality 4
Impact of access to education on gender inequality 4
A case in the hospitality industry 5
Conclusion 5
References 7
References 8
References 9

Introduction

Gender inequality is a situation whereby one’s gender and sex are determined by the social, cultural, and legal aspects that eventually affect the dignity and rights of men and women (Evans, 2017).

This creates stereotyping assumptions that lead to unequal access and enjoyment of the rights of individuals. Important progress on gender inequality has been made globally over the past decade. For example, there has been increased participation of women and people of color on matters of discrimination, sexual assaults, degradation, and exploitation (United Nations, 2020).

Moreover, the gender roles have also become less rigid with an increasing number of women taking up roles that were once left for their male counterparts (Marsiglia, Kulis and LechugaPeña, 2021). There has also been an increased global awareness brought about by the quantity and quality of data that has resulted in a clear view of gender inequality consequences.

This paper provides an analysis of gender inequality in the hospitality industry. It looks at the impact of geographical location on gender equality, factors influencing gender inequality, the impact of access to education on gender inequality, a case of gender inequality in the hospitality industry, and finally, the conclusion.


Impact of geographical location on gender equality

Gender inequality is not evenly distributed around the world. Some regions have moved closer to attaining millennium development goal number III of gender equality promotion and empowering women relative to others (World Bank, 2011).

A look at the inequality distribution across the globe gives a clear indication that the western jurisdiction has championed for gender equality by countering the violation of the rights of women through the enactment of stringent laws and regulations for offenses related to women, girls, and children (Beghini and Umberto, 2019).

However, in regions that practice Islamic religion, more so the Middle East and the Northern part of Africa there are high incidences of male dominance brought about by perceptions that the progress of women is a western concept, a belief that is given high priority in the sharia laws that govern these Islamic regions (Nadeau and Rayamajhi, 2019).

This prevents women and girls from participating in some activities believe to be preserved for their male counterparts creating a male-dominated society.


Factor influencing gender inequality

Several factors influence gender equality across the globe. One such factor is the level of economic development that has a significant impact on the gender inequality gap (Kochhar, Jain-Chandra and Newiak, 2017). Women in developed countries have increased control of their life with improved access to essential services, advanced technologies and are more educated (Publishing, O and Centre, 2010).

On the other hand, in developing countries, evidence suggests that due to poor economic development, women and girls are deprived of economic knowledge with reduced access to essential services leading to gender bias. Culture is also one factor that influences the extent of inequality among men and women. Women have been marginalized on matters of access, contribution, and participation in cultural and social activities such as arts, cinema, theatre, heritage, and music (Bokova, Shaheed and Deloumeaux, 2014).

This has prevented them from achieving their full potential which eventually impedes inclusivity and sustainability. However, for men, the belief they should be the breadwinners in the family creates discrimination in terms of pay for equal work done by both men and women. This discrimination in terms of wages creates a stereotyping assumption that women are less strong and highly imperfect than men.


Impact of access to education on gender inequality

Education plays a fundamental role in the achievement of sustainable development goals. Education that is quality, inclusive, easily accessible, and equitable creates lifetime opportunities for everyone (OECD, 2017). High gender inequality gaps exist in regions where there is limited access to learning and continuity in education such as in Sub-Sahara Africa, North Africa, and the Middle East (Publishing and OECD, 2012).

On the contrary, regions that promote both formal and informal learning, especially in western countries, experience highly reduced incidences of gender inequality. Empirical evidence suggests that there is a strong correlation between access to quality education among girls and women and increased incidences of gender-based violence.

Societies with high incidences of gender-based educational discrimination experience disparities in areas of health, economic stability among the households, early marriages, reduced involvement of women and girls, and increased frequencies of gender-based violence (UNESCO, 2016).

Whereas, there is improved access to services that are essential including health and advanced technologies in societies that are more educated therefore creating opportunities for women and girls to compete effectively in the labour–market with equal pays for equal level of skills, education, and experiences (OECD, 2017).


A case in the hospitality industry

There are high incidences of gender imbalance in the hospitality industry relative to other industries. Promotion and career advancement are limited for women in this industry with statistics suggesting that there is a ninety percent chance that men will get promoted to top-level positions relative to women (Kumar, Dhiman and Dahiya, 2015).

Moreover, work requirements and structure naturally create pressure on women preventing them from balancing between family and career. The industry is oftentimes characterized by working hours that are irregular and involve frequent traveling and relocation thereby creating a high level of stress for women (Costa, Moura and Mira, 2020).

Despite these challenges, the industry is starting to address these issues to accelerate the creation of a more diverse workforce. One such intervention is the strong encouragement of professionalism against the biasness with regards to women by basing employment on performance as opposed to gender (Jauhari, 2008).

Furthermore, women in the industry are now more than ever being educated on the existing barriers and are given the necessary tools required through improved networking and mentorships. This has an impact on increasing their access to various opportunities and improving their level of influence that is equal to men.


Conclusion

In conclusion, gender inequality as a social, cultural, and legal orientation creates stereotyping assumptions that lead to unequal access and enjoyment of the rights of individuals. The inequality is affected by several factors some of which include geographical location, level of economic development, Culture, and access to education among other factors. In terms of geographical location, some regions have moved closer to attaining the millennium development goal of gender equality promotion and empowering women relative to others.

For economic development, women in developed countries have improved access to essential services, advanced technologies and are more educated than their counterparts in developing countries. Culture, on the other hand, creates inequality since women have been marginalized on matters of access, contribution, and participation in cultural and social activities relative to men.

In my opinion, there are high incidences of gender inequality in the hospitality industry relative to other industries with a high chance that men will get promoted to top-level faster than women. However, the industry is starting to address these issues to accelerate the creation of a more diverse workforce through the creation of awareness on the existing barriers and are giving women the necessary tools required to achieve the level of equality required. This is being undertaken through improved networking and mentorships.


References

Beghini, V., Cattaneo, U. and Pozzan, E., 2019. A quantum leap for gender equality: For a better future of work for all. 1st ed. Geneva: International Labour Office.

Bokova, I., Shaheed, F. and Deloumeaux, L., 2014. Gender equality, heritage and creativity. 1st ed. [ebook] Paris: The United Nations Educational, Scientific and Cultural Organization, pp.14-18. Available at:
http://uis.unesco.org/sites/default/files/documents/gender


equality


–


heritage


–


and


–


creativity


–


2014


–


en_1.pdf

[Accessed 29 April 2021].

Costa, V., Moura, A. and Mira, M., 2020. Research on Human Capital and People Management in the Tourism Industry. 1st ed. Business Science Reference.

Evans, M., 2017. The Persistence of Gender Inequality. 1st ed. [ebook] Cambridge: Polity Press, pp.18-23. Available at:


https://books.google.ch/books?hl=en&lr=&id=AWdNDwAAQBAJ&oi=fnd&pg=PR3&dq=E


vans,+M.,+2016.+The+Persistence+of+Gender+Inequality.&ots=XDZfnD1bY6&sig=NGWs


s1MNMHAz3jwVNBNq0rpenBw#v=onepage&q&f=false

[Accessed 29 April 2021].

References

Jauhari, V., 2008. Global cases on hospitality industry. New York, Haworth Press. 1st ed.

Kochhar, K., Jain-Chandra, S. and Newiak, M., 2017. Women, Work, and Economic Growth. 1st ed. [ebook] International Monetary Fund, pp.57-75. Available at:
http://file:///C:/Users/HP/Downloads/[9781513516103%20


–


%20Women,%20Work,%20and%20Economic%20Growth]%20Women,%20Work,%20an


d%20Economic%20Growth.pdf

[Accessed 30 April 2021].

Kumar, S., Dhiman, M. and Dahiya, A., 2015. International Tourism and Hospitality in the Digital

Age. 1st ed. AHTSI, pp.50-99.

Marsiglia, F., Kulis, S. and Lechuga-Peña, S., 2021. Diversity, Oppression, & Change: Culturally

Grounded Social Work. 3rd ed. pp.77-90.

Nadeau, K. and Rayamajhi, S., 2019. Women and Violence. 2nd ed. Global Lives in Focus, pp.34-

78.

References

OECD, 2017. The pursuit of gender equality: an uphill battle. 1st ed. [ebook] Paris: OECD, pp.4489. Available at:
https://read.oecd


–


ilibrary.org/social


–


issues


–


migration


–


health/the


pursuit


–


of


–


gender


–


equality_9789264281318


–


en#page4

[Accessed 31 April 2021].

Publishing, O., and Centre, O. D., 2010. Atlas of Gender and Development How Social Norms Affect Gender Equality in non-OECD Countries. Paris, Organization for Economic Cooperation and Development.

Publishing, and Organization for Economic Co-Operation and Development, 2012. Equity and Quality in Education Supporting Disadvantaged Students and Schools. Paris, OECD Publishing.

UNESCO, 2016. Global guidance on addressing school-related gender-based violence. Paris,

UNESCO.

United Nations, 2020. World Social Report 2020: Inequality in a Rapidly Changing World.

World Bank, 2011. Gender equality and development. Washington, DC, World Bank.

Clinical and Experimental Surgery

S. Karger

Medical and Scientifi c Publishers

Basel . Freiburg . Paris .

London . New York .

New Delhi . Bangkok . Beijing .

Tokyo . Kuala Lumpur .

Singapore . Sydney

Eur Surg Res

49(2) 53–106 (2012) 49 | 2 | 12
print

ISSN 0014–312X

online

e-ISSN 1421–9921

www.karger.com/esr

G
en

er
al

M
ed

ic
in

e;
In

te
rn

al
M

ed
ic

in
e;

C
ar

d
io

va
sc

u
la

r
Sy

st
em

,
G

er
ia

tr
ic

s,
Im

m
u

n
o

lo
g

y,
In

fe
ct

io
u

s
D

is
ea

se
s,

N
eu

ro
lo

g
y,

M

et
ab

o
lis

m
, N

ep
h

ro
lo

g
y,

O
n

co
lo

g
y,

P
h

ar
m

ac
o

lo
g

y,
P

sy
ch

o
lo

g
y,

P

sy
ch

ia
tr

y,
S

o
ci

al
M

ed
ic

in
e,

U
ro

lo
g

y

P l e a s e s e e t h e f u l l c o n t e n t s o n :
www.karger.com/gender_medicine

Handbook of Clinical Gender Medicine
Editors: Schenck-Gustafsson, K. (Stockholm);
DeCola, P.R.; Pfaff , D.W. (New York, N.Y.); Pisetsky, D.S.
(Durham, N.C.)
XVI + 522 p., 62 fi g., 4 in color, 63 tab., soft cover, 2012
CHF 69.– / EUR 51.– / USD 69.00
Prices subject to change
EUR price for Germany, USD price for USA only
ISBN 978–3–8055–9929–0
e-ISBN 978–3–8055–9930–6

GGTATCCAATGATAAGCATGATAAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCATCCAATGATAAGCATGAT
TATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATTGATAAGCGTG ATCCAATGATAAGCATCACGGTATCCCCAATGATAAGCAT
GGTATCCAATGATAAGCATCACGGTATCCCAATGATAAGCATGATAAGCCACGGTATCCAATGAGATAAGCATCACG
GATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGG
AGCATCACGGTATCCAATGATAAGCATGATAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCACAATGATAAGCATCACGGTATCCAATGATAAGCATATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGGATAAGCTCAA CGGTATCCAATGATAAGCATCACGGGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAAGCATCACGGTATCCAATGAATATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATAAGCATGATAAGCTCACGGTATCAGCATGATA
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATCCAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGA CATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCACATGATAAGTCACGGTATCCAATGATAAG
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAATAAGCATGATAAGCTCACGGTATCC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAAAGCATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATAAGCATGATA AA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGGTATC
AGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTGTATCCAATG
GGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCGCATGATA
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATTAAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAA
CAATGATAAGCATCACGGTATCCAATGATAAG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA
AGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAG
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC

TGATA
ATCCA

GATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATG
GGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAT
TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGG
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC
AGCATCACGGTATCCAATGATAAGCATGATAAGCGTAT
GGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACG
GATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGG
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAATGAT
AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA
TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA
CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC
AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC
AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA

TAATCCCAAATGATTAACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCGGTATCCAATGAATAAGCATGATAAA CTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATCCAAATGA AAGCCATCACGGTAT CAATGATAAGCAAT

GCATTGATAAGATAAGGTATCGGTATCTATCCCAATGCATCACGGTATCCGCATCACGGTATCCCACGGTATCCAATGCAACGGTATCCCAATGACGGACGGTACGGTACGGTACGGACGGTACGGTCGCGCGACGGACCA TGAGAGAGATGATGATTGATGATGATGATATAAAAAAAAGAGAAAAAAAAAAAA

AGCCATTCACGGGTAATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGCATCACGGTATCCAAAGCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAAGCATAAGGCATCACGGGTATCCAATGATAAGCATGATAAGCTCAACGGTATCCAATGATAAGCATCACGGTAAAAAAACCCCCGGCCGGGGGGG CCACAAAAAAAAAAATATA
AGCATAG CACGGGTATCCAATGATAAGCATGATAAG
AATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT
TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAATGATAAGCATCACGGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA

TAAAGCAATGATACAATGATTAATGATAAGCTGATAAGCCATTGATAAAGATCCAATGATAAGATTCCAATGATATAAGGCATGATAAGCTCGCCATGATAAGGCTCACGGAAGCATGATAGCATGATATCACGGTATCACGGTGTGTTGTTTATCCAATCCAATCCAATCCATCCAATCCAATCCATCCATCCACCATCCATCCAATCCACCACCAAA AAAAAAAAAACGGACGACGGACGACGGACGGACGACGGACGGACGGGGACGGACGACGACGA GCAGCACGCACAGCACACACACACAGCAGCATGTGTGTGATGATGATTGATGTGATGAGTGAGTG

Handbook of
Clinical Gender
Medicine
Editors

Karin Schenck-Gustafsson
Paula R. DeCola
Donald W. Pfaff
David S. Pisetsky

K
I 1

2
4

3
5

A new vision to understanding medicine

Handbook of
Clinical Gender
Medicine
Editors

Karin Schenck-Gustafsson
Paula R. DeCola
Donald W. Pfaff
David S. Pisetsky

Gender medicine is an important new fi eld in
health and disease. It is derived from top-quality
research and encompasses the biological and so-
cial determinants that underlie the susceptibility
to disease and its consequences. In the future, con-
sideration of the role of gender will undoubtedly
become an integral feature of all research and
clinical care.
Defi ning the role of gender in medicine requires a
broad perspective on biology and diverse skills in
biomedical and social sciences. When these scien-
tifi c disciplines come together, a revolution in
medical care is in the making. Covering twelve dif-
ferent areas of medicine, the practical and useful
‘Handbook of Clinical Gender Medicine’ provides
up-to-date information on the role of gender in the
clinical presentation, diagnosis, and management
of a wide range of common diseases.
The contributing authors of this handbook are all
experts who, in well-referenced chapters, cogently
and concisely explain how incorporation of gender
issues into research can aff ect the medical under-
standing and treatment of heart disease, osteopo-
rosis, arthritis, pain, violence, and malaria among
other conditions. This intriguing and unique med-
ical textbook provides readers with a valuable new
perspective to understand biology and incorpo-
rate gender issues into the diff erent branches of
medicine.

Contents

Foreword: Wainer, J.; Wainer, Z.
Preface: Schenck-Gustafsson, K.

Introduction
Gender Matters: Wainer, J.; Wainer, Z.
Biological Sex and the Genome: What Makes

Us Ourselves? Legato, M.J.

Social and Biological Determinants in
Health and Disease
Section Editors: DeCola, P.R.; Schober, J.M.

Central Nervous System and
Clinical Applications
Section Editor: Pfaff , D.W.

Neurology
Section Editor: Olsson, T.

Pain
Section Editor: Murphy, A.Z.

Circulation
Section Editor: Schenck-Gustafsson, K.

Cancer
Section Editor: Gustafsson, J.-Å.

Metabolic Disease
Section Editor: Werner, S.

Autoimmune, Infl ammatory, and
Musculoskeletal Disease
Section Editor: Pisetsky, D.S.

Infectious Diseases
Section Editor: Britton, S.

Urology, Sexual Dysfunction,
and Nephrology
Section Editor: Arver, S.

Pharmaceutical Drugs
Section Editor: Parekh, A.

Geriatrics
Section Editor: Herlitz, A.

Please send: copy/ies

Postage and handling free with prepayment

Payment:
Please charge to my credit card
� American Express � Diners
� MasterCard � Visa

Card No.:

Exp. date:

CVV/CVC
(3 digits in the signature fi eld on the back of Visa and MasterCard)

� Check enclosed � Please bill me

Orders may be placed with any bookshop, subscription
agency, directly with the publisher or through a Karger
distributor.

Fax: +41 61 306 12 34

S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland)
E-Mail orders@karger.ch, www.karger.com

Name/Address:

Date:

Signature:

O
r

d
e

r

F
o

r
m

Printed in Switzerland
on acid-free and non-aging
paper (ISO 9706) by
Reinhardt Druck, Basel

Appears 6-weekly:
2 volumes per year
(8 issues)

Editor-in-Chief

B. Vollmar, Rostock

Accociate Editors

M. Boros, Szeged
M. Büchler, Heidelberg
W.P. Ceelen, Ghent
M.D. Menger, Homburg/Saar
H. Thorlacius, Malmö/Lund

Editorial Board

I. Alwayn, Halifax
D.K. Bartsch, Marburg
C. Bassi, Verona
W.O. Bechstein, Frankfurt am Main
J.A. Bradley, Cambridge
M. Cikirikcioglu, Geneva
P.-A. Clavien, Zurich
C. Eipel, Rostock
R.W.F. de Bruin, Rotterdam
H. Friess, Munich

S. Fichtner-Feigl, Regensburg
G. Galata, London
D.J. Gouma, Amsterdam
J.K. Habermann, Lübeck
M. Heberer, Basel
W.R. Jarnagin, New York, NY
J.C. Kalff, Bonn
M.W. Laschke, Homburg/Saar
H.-A. Lehr, Lausanne
C.M. Malata, Cambridge
T. Minor, Bonn
M. Morino, Torino
J. Pirenne, Leuven
R. Schramm, Munich
L. Steinstraesser, Bochum
T.M. van Gulik, Amsterdam
M.A. Venermo, Helsinki
D.C. Winter, Dublin
Y. Yamamoto, Akita

Clinical and Experimental Surgery

Founded 1969
Editors: W. Brendel (1975–1989†) and K. Messmer (1975–2005); O. Kempski
(2005–2011)

GzD 2012

EB
GL
GI

Fax +41 61 306 12 34
E-Mail karger@karger.ch
www.karger.com

© 2012 S. Karger AG, Basel

The Guidelines for Authors are available at:
www.karger.com/esr_Guidelines

Guidelines for Authors

Aims and Scope
The prime mission of European Surgical Research is to
publish high-quality original manuscripts of basic and
translational research and review articles concerned with
laboratory and clinical investigations which are relevant
to surgical practice and of general interest to a broad
range of academic surgeons and surgical researchers.
Manuscripts dealing with research relevance to human
surgical diseases are given high priority along with those
which explore the pathogenesis, etiology, and mecha-
nisms of disease processes. European Surgical Research
seeks to preferentially publish research articles that in-
tegrate molecular biological methods, along with func-
tional studies, into the analysis of biological questions
and that advance basic and translational knowledge of
surgical pathophysiology. European Surgical Research
will provide an international platform for basic and
translational research and clinical investigations impact-
ing directly on surgical care and management. European
Surgical Research also features special articles relating to
educational, research, or social issues of interest to the
academic surgical community.

Submission
Only original papers written in English are considered
and should be submitted online:

www.karger.com/esr

All manuscripts must be accompanied by a cover letter
and copyright signed by all authors. Assurance should be
given in the cover letter that the manuscript is not un-
der simultaneous consideration by any other publication.

Authors may suggest up to five referees who have expert
knowledge on the subject. Suggested referees should not
be from the same institution, not have published with
the authors during the last 5 years, and should not be
prejudiced.

Manuscripts may be submitted to the following sections:
(1) Original Papers on basic, translational and clinical
science
(2) Technical Notes
(3) Systematic Reviews and Meta-Analyses

Original Papers: These manuscripts should represent
original research in basic, translational, or clinical sci-
ence. Consideration for publication is based on originali-
ty, novelty, scientific soundness, and appropriate analysis.
European Surgical Research encourages the submission of
relevant and well-conducted work in basic, experimental,
and clinical science. Manuscripts should be prepared ac-
cording to the guidelines for original papers.

Technical Notes: These manuscripts present a new meth-
od, experimental model, test procedure, tool, or algo-
rithm that is relevant for surgical research and signifi-
cantly advances current available knowledge.

Systematic Reviews and Meta-Analyses: European Sur-
gical Research aims to publish expert basic and transla-
tional reviews of selected up-to-date topics in experimen-
tal surgery. On occasion, the Editor-in-Chief will invite
additional clinical or basic science reviews on a specific
topic, which are usually presented pair-wise. Exceptions
include formal true Systematic Reviews with Meta-Anal-
yses which are well performed, and which are considered
Original Papers.

Should you experience any problems with your submis-
sion, please contact: esr@karger.ch

Editorial Office ‘European Surgical Research’
S. Karger AG
Angela Lorenz
PO Box
CH–4009 Basel (Switzerland)
Tel. +41 61 306 13 58
Fax +41 61 306 14 34

Conditions
All manuscripts are subject to editorial review. Manu-
scripts are received with the explicit understanding that
they are not under simultaneous consideration by any
other publication. Submission of an article for publica-
tion implies transfer of the copyright from the author to
the publisher upon acceptance. Accepted papers become
the permanent property of European Surgical Research
and may not be reproduced by any means, in whole or in
part, without the written consent of the publisher. It is the
author’s responsibility to obtain permission to reproduce
illustrations, tables, etc. from other publications.

Disclosure Statement
Authors are required to disclose any sponsorship or
funding arrangements relating to their research and all
authors should disclose any possible conflicts of interest.
Disclosure statements will be published at the end of the
text of the article.

Plagiarism Policy
Whether intentional or not, plagiarism is a serious vio-
lation. We define plagiarism as a case in which a paper
reproduces another work with at least 25% similarity and
without citation.
If evidence of plagiarism is found before/after acceptance
or after publication of the paper, the author will be offered
a chance for rebuttal. If the arguments are not found to
be satisfactory, the manuscript will be retracted and the
author sanctioned from publishing papers for a period to
be determined by the responsible Editor.

Ethics
Published research must comply with the guidelines for
human studies and animal welfare regulations. Authors
should state that subjects have given their informed con-
sent and that the study protocol has been approved by the
institute’s committee on human research. Further, they
should also state that animal experiments conform to in-
stitutional standards. Authors are required to declare the
approval codes obtained from the corresponding ethical
committee on human and/or animal research.

Arrangement
The manuscript should conform to the following or-
der: title page, abstract and key words, body, acknowl-
edgments, references, figure legends, tables and figures.
Manuscripts should be written in high-quality English
suitable for effective communication to a professional
medical audience. Authors who are not native speakers
of English sometimes receive negative comments from
referees or editors about the English-language usage in
their manuscripts, and these problems can contribute to
the decision to reject a paper. To help reduce the possi-
bility of such problems, we strongly encourage such au-
thors (i) to have their manuscript reviewed for clarity by
a colleague whose native language is English and/or (ii)
to use one of the many English language editing services
that are available via the Web.
All pages, including the figure legends, should be num-
bered in sequence, and the first author’s name should ap-
pear at the upper right corner of each page. Papers not
conforming to the journal style will be returned with-
out review.

Title page: The first page of each paper should indicate a
concise title of no more than 150 characters, all authors’
names (first name and surname), authors’ institutional
affiliations, and a short title for use as running head.

Corresponding author: The exact postal address of
author(s) to whom correspondence, proofs, and reprint
requests should be sent, including the postal code, must
be given at the bottom of the title page. Please also supply
phone and number and e-mail address.

Abstract: Submit the abstract on a separate page. The ab-
stract is structured into Background/Purpose, Methods,
Results and Conclusions and should be less than 400
words in length.

Key words: Following the abstract, an alphabetical list
of five key words that reflect the content of the paper
should be given.

Footnotes: Avoid footnotes.

Body of manuscript: The text should be organized into: In-
troduction, Materials and Methods, Results, Discussion,
Acknowledgments, including grant numbers and sourc-
es of support, Disclosure/Duality of Interest (optional),
and References. Abbreviations/acronyms are defined in
both the abstract and body of the text as follows: vascular
permeability factor (VPF); transforming growth factor-
b (TGF-b). They should only be used in the abstract if
they appear twice after first being mentioned and in the
body of the text only if they appear three times after first
being mentioned.

Tables and illustrations: Tables and illustrations (both
numbered in sequential Arabic numerals) should be pre-
pared as separate files. Tables require a brief and concise
heading. Figures require a legend, prepared as a separate
page, after references. Please use scale markers for elec-
tron micrographs, and indicate the type of stain used. For
the reproduction of illustrations, only good drawings and
original photographs can be accepted; negatives or pho-
tocopies cannot be used. Due to technical reasons, fig-
ures with a screen background should not be submitted.
When possible, group several illustrations in one block
for reproduction (max. size 180  223 mm) or provide
crop marks. Electronically submitted b/w half-tone and
color illustrations must have a final resolution of 300 dpi
after scaling, line drawings one of 800–1,200 dpi.

Color illustrations
Online edition: Color illustrations are reproduced free of
charge. In the print version, the illustrations are repro-
duced in black and white. Please avoid referring to the
colors in the text and figure legends.
Print edition: Up to 6 color illustrations per page can
be integrated within the text at CHF 800.– per page.

References: In the text identify references by Arabic
numerals [in square brackets]. Material submitted for
publication but not yet accepted should be noted as
‘unpublished data’ and not be included in the refer-
ence list. The list of references should include only
those publications which are cited in the text. Do not
alphabetize; number references in the order in which
they are first mentioned in the text. The surnames of the
authors followed by initials should be given. There
should be no punctuation other than a comma to sepa-
rate the authors. Preferably, please cite all authors. Ab-
breviate journal names according to the Index Medicus
system. Also see International Committee of Medical
Journal Editors: Uniform requirements for manuscripts
submitted to biomedical journals (www.icmje.org).

Guidelines for Authors

Examples
(a) Papers published in periodicals: Chatel J-M, Bernard
H, Orson FM: Isolation and characterization of two com-
plete Ara h 2 isoforms cDNA. Int Arch Allergy Immunol
2003;131:14–18.
(b) Papers published only with DOI numbers:
Theoharides TC, Boucher W, Spear K: Serum inter-
leukin-6 reflects disease severity and osteoporosis
in mastocytosis patients. Int Arch Allergy Immunol
DOI: 10.1159/000063858.
(c) Monographs: Matthews DE, Fare-well VT: Using and
Understanding Medical Statistics, ed 3, revised. Basel,
Karger, 1996.
(d) Edited books: DuBois RN: Cyclooxygenase-2 and
colorectal cancer; in Dannenberg AJ, Dubois RN (eds):
COX-2. Prog Exp Tum Res. Basel, Karger, 2003, vol 37,
pp 124–137.

Reference Management Software: Use of EndNote is
recommended for easy management and formatting
of citations and reference lists.

Digital Object Identifier (DOI)
S. Karger Publishers supports DOIs as unique identifiers
for articles. A DOI number will be printed on the title
page of each article. DOIs can be useful in the future for
identifying and citing articles published online without
volume or issue information. More information can be
found at www.doi.org.

Supplementary Material
Supplementary material is restricted to additional data
that are not necessary for the scientific integrity and con-
clusions of the paper. Please note that all supplementary
files will undergo editorial review and should be submit-

ted together with the original manuscript. The Editors
reserve the right to limit the scope and length of the sup-
plementary material. Supplementary material must meet
production quality standards for Web publication with-
out the need for any modification or editing. In general,
supplementary files should not exceed 10 MB in size. All
figures and tables should have titles and legends and all
files should be supplied separately and named clearly. Ac-
ceptable files and formats are: Word or PDF files, Excel
spreadsheets (only if the data cannot be converted prop-
erly to a PDF file), and video files (.mov, .avi, .mpeg).

Author’s ChoiceTM
Karger’s Author’s ChoiceTM service broadens the reach
of your article and gives all users worldwide free and full
access for reading, downloading and printing at www.
karger.com. The option is available for a one-time fee of
CHF 3000.–, which is a permissible cost in grant alloca-
tion. More information can be found at www.karger.com/
authors_choice.

NIH-Funded Research
The U.S. National Institutes of Health (NIH) mandates
under the NIH Public Access Policy that final, peer-re-
viewed manuscripts appear in its digital database within
12 months of the official publication date. As a service to
authors, Karger submits your manuscript on your behalf
to PubMed Central (PMC) immediately upon publica-
tion. It usually receives a PMCID within approximately
a month and will appear in PMC after 12 months. For
those selecting our premium Author’s ChoiceTM service,
the usual embargo will be overridden, accelerating the
accessibility of your work.

Self-Archiving
Karger permits authors to archive their pre-prints (i.e.
pre-refereeing) or post-prints (i.e. final draft post-refer-
eeing) on their personal or institution’s servers, provid-
ed the following conditions are met: Articles may not be
used for commercial purposes, must be linked to the pub-
lisher’s version, and must acknowledge the publisher’s
copyright. Authors selecting Karger’s Author’s ChoiceTM
feature, however, are also permitted to archive the final,
published version of their article, which includes copy-
editing and design improvements as well as citation links.

Page Charges
A charge of CHF 125.– per page will be levied for the first
4 printed pages of an article. Any additional page will be
charged to the author at CHF 325.–. The allotted size of a
paper is equal to approx. 12 manuscript pages (including
tables, illustrations and references).

Proofs
Unless indicated otherwise, proofs are sent to the cor-
responding author and should be returned with the least
possible delay. Alterations other than the correction of
printer’s errors are charged to the author.

Reprints
Order forms and a price list are sent with the proofs. Or-
ders submitted after the issue is printed are subject to
considerably higher prices.

Frontiers of Gastrointestinal Research

Editor: C. Sakamoto

Vol. 30

Cell/Tissue Injury and
Cytoprotection/Organoprotection
in the Gastrointestinal Tract
Mechanisms, Prevention and Treatment

Editors

L. Filaretova
K. Takeuchi

Frontiers of
Gastrointestinal Research
ISSN 0302–0665
e-ISSN 1662–3754

Listed in bibliographic services,
including Current Contents®,
Reference Update, Biological Abstracts.

Vol. 30: Cell/Tissue Injury and
Cytoprotection/Organoprotec-
tion in the Gastrointestinal
Tract
Mechanisms, Prevention and Treatment
Editors: Filaretova, L.P. (St. Petersburg);
Takeuchi, K. (Kyoto)
VIII + 250 p., 49 fi g., 10 tab., hard
cover, 2012
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–318–02183–7
e-ISBN 978–3–318–02184–4

Vol. 29: Free Radical Biology in
Digestive Diseases
Editors: Naito, Y. (Kyoto);
Suematsu, M. (Tokyo); Yoshikawa, T.
(Kyoto)
VIII + 176 p., 36 fi g., 3 in color, 9 tab.,
hard cover, 2011
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–8055–9609–1
e-ISBN 978–3–8055–9610–7

Vol. 28: Ascites, Hyponatremia
and Hepatorenal Syndrome:
Progress in Treatment
Editor: Gerbes, A.L. (Munich)
VIII + 212 p., 23 fi g., 31 tab.,
hard cover, 2011
CHF 182.– / EUR 152.– / USD 214.00
ISBN 978–3–8055–9591–9
e-ISBN 978–3–8055–9592–6

Vol. 27: Interventional and
Therapeutic Gastrointestinal
Endoscopy
Editors: Mönkemüller, K. ( Bottrop);
Wilcox, C.M. (Birmingham, Ala.);
Muñoz-Navas, M. (Pamplona)
X + 548 p., 386 fi g., 270 in color,
88 tab., hard cover, 2010
CHF 248.– / EUR 207.– / USD 292.00
ISBN 978–3–8055–9308–3
e-ISBN 978–3–8055–9309–0

Frontiers of
Gastrointestinal Research
A guide to leading investigations in the fi eld of gastroenterology

This series is designed for both the physician active in the clinical practice of gastroenterol-
ogy and the gastroenterologist or student engaged in research. Each volume offers a ready
reference guide to current progress and a review of past achievement in a particular area
of gastrointestinal study. The series covers pathological, pharmacological, diagnostic and
therapeutic considerations relating to the digestive system, as well as the latest techniques
and instrumentation used in the management of gastrointestinal disorders.

KI
1

21
19

Series Editor

C. Sakamoto (Tokyo)

Read it online:
www.karger.com/fgare

Prices subject to change
EUR price for Germany, USD price for USA only

Fax +41 61 306 12 34
E-Mail karger@karger.ch
www.karger.com

© 2012 S. Karger AG, Basel

The Journal Home Page is available at:
www.karger.com/esr

General Information

ISSN Print Edition: 0014–312X
ISSN Online Edition: 1421–9921

Journal Homepage: www.karger.com/esr

Publication Data: ‘European Surgical Research’ is
published 8 times a year. Volumes 48 and 49, each with
4 issues, appear in 2012.

Copyright: © 2012 S. Karger AG, Basel (Switzerland).
All rights reserved. No part of this publication may be
translated into other languages, reproduced or utilized
in any form or by any means, electronic or mechanical,
including photocopying, recording, microcopying, or
by any information storage and retrieval system, with-
out permission in writing from the publisher or, in the
case of photocopying, direct payment of a specified fee
to the Copyright Clearance Center.

Disclaimer: The statements, opinions and data con-
tained in this publication are solely those of the indi-
vidual authors and contributors and not of the publish-
er and the editor(s). The appearance of advertisements
in the journal is not a warranty, endorsement, or ap-
proval of the products or services advertised or of their
effectiveness, quality or safety. The publisher and the
editor(s) disclaim responsibility for any injury to per-
sons or property resulting from any ideas, methods,
instructions or products referred to in the content or
advertisements.

Subscription Rates: Subscriptions run for
a full calendar year. Prices are given per year.
Personal subscription:

Print or Online Print+Online combined
CHF 747.– CHF 843.–
EUR 598.– EUR 674.–
USD 725.00 USD 819.00
postage and handling (added to print and print+online)
CHF 54.40 Europe, CHF 80.– Overseas
EUR 41.60
USD 75.20

Institutional subscription:
Print or Online Print+Online combined
CHF 2490.– CHF 2740.–
EUR 1992.– EUR 2192.–
USD 2418.00 USD 2660.00
postage and handling (added to print and print+online)
CHF 68.– Europe, CHF 100.– Overseas
EUR 52.–
USD 94.00

Airmail surcharge: CHF 68.– / USD 64.00

Back Volumes and Single Issues: Information on
availability and prices of single print issues and print
or electronic back volumes can be obtained from Cus-
tomer Service at service@karger.ch.

Bibliographic Indices: This journal is regularly listed
in bibliographic services, including Current Contents®
and PubMed/MEDLINE.

Photocopying: This journal has been registered with
the Copyright Clearance Center (CCC), as indicated by
the code appearing on the first page of each article. For
readers in the US, this code signals consent for copying
of articles for personal or internal use, or for the per-
sonal or internal use of specific clients, provided that
the stated fee is paid per copy directly to

Copyright Clearance Center Inc.
222

Topic: Impact of Divorce on Children 

Assignment #2  2Pg

Use the topic and answer these questions below: 

How has the problem been addressed so far? What has been the result? 

Who are the stakeholders? Are there opposing sides of the issue? 

Are there marginalized voices that should be included?

Must answer these questions thoroughly. 

Focus more on what comes of the children. Data and Statistics 

Sheet1

0 research question study design sample size and method independent variables and method dependable variables and measures results general strengths general weakness overall summary quality of study
Azarpazhooh, A., Lawrence, H. P., & Shah, P. S. (2016). Xylitol for preventing acute otitis media in children up to 12 years of age. Cochrane database of systematic reviews, (8). To evaluate the efficacy and safety of xylitol for the prevention of acute myeloid leukemia (AOM) in children ages 12 and under Meta-analysis – no reviews of any type allowed Randomised controlled trials Xylitol acute myeloid Leukemia In the initial systematic search, 1826 articles were found, with potentially eligible articles being retrieved in full text. The network meta – analysis (equivalent to 3 RCTs) with 3405 participants that met the inclusion criteria A natural sweetener called xylitol has been shown to reduce the risk of tooth decay in products such as chewing gum, candy, toothpaste, and prescription medications over time. There were only a few papers included in the meta-analysis, and the vast majority of those studies all came from the same study organization. The administration of xylitol as a preventative measure to healthy children in childcare centers has been shown in studies of moderate quality to minimize the occurrence of AOM. good
Ferreira, L. A., Grossmann, E., Januzzi, E., Gonçalves, R. T. R. F., Mares, F. A. G., Paula, M. V. Q. D., & Carvalho, A. C. P. (2015). Ear acupuncture therapy for masticatory myofascial and temporomandibular pain: a controlled clinical trial. Evidence-based complementary and alternative medicine, 2015 Is Ear Acupuncture Therapy for Masticatory Myofascial and Temporomandibular Pain, A Controlled Clinical Trial ? – this has nothing to do with ear infections, children, or chewing gum clinical trial 20 patience were randomized to 2 groups of 10 each Ear acupuncture pain sensation In both groups, symptoms of muscle and joint pain decreased statistically significantly with therapy with either of the two well-established therapeutic approaches. Adjunctive therapies like acupuncture can help patients improve their quality of life by reducing chronic symptoms. Small sample size, long-term monitoring, comparison with a placebo control group, and post-treatment evaluation are the key issues that arise. Ear acupuncture adjunct therapy has reduced muscle and joint TMD pain symptoms more quickly and dramatically than solitary occlusal therapy in short-term treatment. fair
Rai, S., Koirala, K., & Sharma, V. (2013). Role of nasal decongestants in spontaneous healing of traumatic tympanic membrane perforation. Nepalese Journal of ENT Head and Neck Surgery, 5(1), 14-16 To examine the role of nasal decongestants in the healing of tympanic membrane ruptures that result from trauma. – this also has nothing to do with your PICO prospective studies randomized study sample size 58 patientss divided into 2 groups Traumatic Perforation decongestants On average, 51.7% of patients in our series had damage to their left side, while 32.8% of patients had damage to their right ear, and 15.5% of patients had injuries on both sides of their ears. This could be due to the fact that because the majority of people are right-handed and because the left ear was slapped as a result of slapping Oral and nasal decongestants were found to aid in the creation of an environment conducive for the spontaneous repair of traumatic TM perforation in this study. patients’ eustachian tubes often become dysfunctional as a result of the common cold’s rapid and repetitive weather changes in our region. The likelihood of spontaneous healing of traumatic tympanic membrane perforations rises with regular use of nasal decongestants. good
Ngo, C. C., Massa, H. M., Thornton, R. B., & Cripps, A. W. (2016). Predominant bacteria detected from the middle ear fluid of children experiencing otitis media: a systematic review. PloS one, 11(3), e0150949. Are bacteria found in the middle ear fluid of children with Otitis Media? meta-analysis random sampling, AOM/RAOM microbial etiology ear infection In the initial systematic search, 9617 articles were found, with 888 potentially eligible articles being retrieved in full text. The network meta – analysis includes 66 publications (equivalent to 126 RCTs) with 10483 participants that met the inclusion criteria. Continuous monitoring of OM pathogens using proper detection technologies can aid in the development of better vaccinations to guard against the complex combination of otopathogens found in the middle ear. The pathophysiology of this condition is poorly understood, making it difficult to create effective intervention options. S. pneumoniae, H. influenzae, and M. catarrhalis have remained surprisingly consistent as the leading bacteria causative for OM locally within the middle ear of children over the world for the past 40 years. good
Marom, T., Marchisio, P., Tamir, S. O., Torretta, S., Gavriel, H., & Esposito, S. (2016). Complementary and alternative medicine treatment options for otitis media: a systematic review. Medicine, 95(6). what are the alternativ medicine treatment of ear infection? prospective studies – this is also a review article Randomized controlled trials sample were children conventory and alternative medicine, medical therapies otitis media Alternative treatments for ear infection include probiotics, vitamin D supplementation, chiropractic, osteopathy, and acupuncture. CAM makes an attempt to provide a customised approach to the sick child, taking into consideration the parents’ previous experiences. The value of complementary and alternative medicine (CAM) therapies in the treatment of Otitis media has not been established. The medical profession no longer considers complementary and alternative medicine (CAM) a legitimate treatment option for OM because of the lack of scientific data backing it. moderate
hyperkinks
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150950
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.hindawi.com/journals/ecam/2015/342507/
https://sci-hub.se/10.3126/njenthns.v5i1.16854
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/
PICO Is chewing gum(I) effective in reducing pain(O) in children with ear infection(P) when compared to decongestants(C)
Database googlescholar.com
keywords Otitis media, Decongestanta, chewing gum,troumer perferation,ear acupuncture, pain sensation, Xylitol, Acute Myloid Leukemia

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.hindawi.com/journals/ecam/2015/342507/
https://sci-hub.se/10.3126/njenthns.v5i1.16854
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/

Sheet1

0 research question study design sample size and method independent variables and method dependable variables and measures results general strengths general weakness overall summary quality of study
Azarpazhooh, A., Lawrence, H. P., & Shah, P. S. (2016). Xylitol for preventing acute otitis media in children up to 12 years of age. Cochrane database of systematic reviews, (8). To evaluate the efficacy and safety of xylitol for the prevention of acute myeloid leukemia (AOM) in children ages 12 and under Meta-analysis Randomised controlled trials Xylitol acute myeloid Leukemia In the initial systematic search, 1826 articles were found, with potentially eligible articles being retrieved in full text. The network meta – analysis (equivalent to 3 RCTs) with 3405 participants that met the inclusion criteria A natural sweetener called xylitol has been shown to reduce the risk of tooth decay in products such as chewing gum, candy, toothpaste, and prescription medications over time. There were only a few papers included in the meta-analysis, and the vast majority of those studies all came from the same study organization. The administration of xylitol as a preventative measure to healthy children in childcare centers has been shown in studies of moderate quality to minimize the occurrence of AOM. good
Ferreira, L. A., Grossmann, E., Januzzi, E., Gonçalves, R. T. R. F., Mares, F. A. G., Paula, M. V. Q. D., & Carvalho, A. C. P. (2015). Ear acupuncture therapy for masticatory myofascial and temporomandibular pain: a controlled clinical trial. Evidence-based complementary and alternative medicine, 2015 Is Ear Acupuncture Therapy for Masticatory Myofascial and Temporomandibular Pain, A Controlled Clinical Trial ? clinical trial 20 patience were randomized to 2 groups of 10 each Ear acupuncture pain sensation In both groups, symptoms of muscle and joint pain decreased statistically significantly with therapy with either of the two well-established therapeutic approaches. Adjunctive therapies like acupuncture can help patients improve their quality of life by reducing chronic symptoms. Small sample size, long-term monitoring, comparison with a placebo control group, and post-treatment evaluation are the key issues that arise. Ear acupuncture adjunct therapy has reduced muscle and joint TMD pain symptoms more quickly and dramatically than solitary occlusal therapy in short-term treatment. fair
Rai, S., Koirala, K., & Sharma, V. (2013). Role of nasal decongestants in spontaneous healing of traumatic tympanic membrane perforation. Nepalese Journal of ENT Head and Neck Surgery, 5(1), 14-16 To examine the role of nasal decongestants in the healing of tympanic membrane ruptures that result from trauma. prospective studies randomized study sample size 58 patientss divided into 2 groups Traumatic Perforation decongestants On average, 51.7% of patients in our series had damage to their left side, while 32.8% of patients had damage to their right ear, and 15.5% of patients had injuries on both sides of their ears. This could be due to the fact that because the majority of people are right-handed and because the left ear was slapped as a result of slapping Oral and nasal decongestants were found to aid in the creation of an environment conducive for the spontaneous repair of traumatic TM perforation in this study. patients’ eustachian tubes often become dysfunctional as a result of the common cold’s rapid and repetitive weather changes in our region. The likelihood of spontaneous healing of traumatic tympanic membrane perforations rises with regular use of nasal decongestants. good
Ngo, C. C., Massa, H. M., Thornton, R. B., & Cripps, A. W. (2016). Predominant bacteria detected from the middle ear fluid of children experiencing otitis media: a systematic review. PloS one, 11(3), e0150949. Are bacteria found in the middle ear fluid of children with Otitis Media? meta-analysis random sampling, AOM/RAOM microbial etiology ear infection In the initial systematic search, 9617 articles were found, with 888 potentially eligible articles being retrieved in full text. The network meta – analysis includes 66 publications (equivalent to 126 RCTs) with 10483 participants that met the inclusion criteria. Continuous monitoring of OM pathogens using proper detection technologies can aid in the development of better vaccinations to guard against the complex combination of otopathogens found in the middle ear. The pathophysiology of this condition is poorly understood, making it difficult to create effective intervention options. S. pneumoniae, H. influenzae, and M. catarrhalis have remained surprisingly consistent as the leading bacteria causative for OM locally within the middle ear of children over the world for the past 40 years. good
Marom, T., Marchisio, P., Tamir, S. O., Torretta, S., Gavriel, H., & Esposito, S. (2016). Complementary and alternative medicine treatment options for otitis media: a systematic review. Medicine, 95(6). what are the alternativ medicine treatment of ear infection? prospective studies Randomized controlled trials sample were children conventory and alternative medicine, medical therapies otitis media Alternative treatments for ear infection include probiotics, vitamin D supplementation, chiropractic, osteopathy, and acupuncture. CAM makes an attempt to provide a customised approach to the sick child, taking into consideration the parents’ previous experiences. The value of complementary and alternative medicine (CAM) therapies in the treatment of Otitis media has not been established. The medical profession no longer considers complementary and alternative medicine (CAM) a legitimate treatment option for OM because of the lack of scientific data backing it. moderate
hyperkinks
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949 https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150950
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.hindawi.com/journals/ecam/2015/342507/
https://sci-hub.se/10.3126/njenthns.v5i1.16854
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/
PICO Is chewing gum(I) effective in reducing pain(O) in children with ear infection(P) when compared to decongestants(C)
Database googlescholar.com
keywords Otitis media, Decongestanta, chewing gum,troumer perferation,ear acupuncture, pain sensation, Xylitol, Acute Myloid Leukemia

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0150949
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD007095.pub3/abstract?cookiesEnabled
https://www.hindawi.com/journals/ecam/2015/342507/
https://sci-hub.se/10.3126/njenthns.v5i1.16854
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4753897/

Home>Nursing homework help
nursingmana

 

Search for an article written by an author who works within your chosen career field by:

  • Accessing the University Library and searching by subject
  • Using another tool of your choice

 As you review the article you select, consider not only what is written,  but how it is written. Make observations about the writing style and  prepare to share those details with the class. 

 

Discuss the elements of rhetorical situation by responding to the following in a minimum of 175 words: 

  • Which article did you select?
  • What was the author’s purpose for writing the article? 
  • Who was the author’s target audience?
  • How might you describe the writer’s general tone of voice? 
  • How does this author establish their credibility in this field?
  • Is this a credible source? How can you tell?
  • What other details about how the article was written stood out to you as important?

 Include a reference list at the end of your post that credits the piece you read. Use a citation generator, such as the Reference & Citation Generator  in the Center for Writing Excellence, to cite the article in your  response. Format your in-text citations (e.g., Adams, 2016, p. 23) and  reference list (i.e., list of resources at the end of the document)  using APA format. Consult the References page on the APA Style website for assistance.  

    • 9
    Report Issue

    2

    PICOT Question:

    A patient of age 40 years is diagnosed with some lung problems and admitted to hospital. How effective will be the strategy of cessation of smoking for the period of two months to overcome the lung problems as compared to chemotherapy and inhalers

    p

    A 40year-old patient diagnosed with lung cancer

    The most common cancer-related cause of death in the United States is malignant lung tumors. As many as 83 percent of lung cancer patients continue to smoke after being diagnosed with the disease, according to a recent study. People with early-stage lung cancer who smoke have an almost twofold increased risk of dying from the condition if they continue to smoke. Cigarette smoking is responsible for as many as 90 percent of all lung cancer cases, according to current estimates. Lung cancer is diagnosed in 24–60% of patients, compared to 12–29% of the general population in the United States. Up to 83% of people with lung cancer who have been diagnosed with smoking after obtaining the diagnosis, continue to smoke. (Cataldo, et al, 2010)

    I

    cessation of smoking

    Preparation, intervention, and maintenance make up the three components of smoking cessation therapy (Stead, et al, 2013). In order to boost both a smoker’s desire to stop and his or her belief in one’s own ability to succeed in their efforts, it is important to take actions to prepare. Intervention can come in a variety of forms to help smokers kick the habit. Long-term sobriety involves the practice of maintenance, which may include encouragement, coping techniques, and the use of behavioral substitutions. Smokers who want to completely quit smoking typically follow the advice of a medical practitioner. Quitting smoking can be made easier with the help of public or private smoking cessation kits, books, recordings, and over-the-counter medications, as well as private smoking cessation packages. An example of how one group might benefit from the assistance of another is the Great American Smoke out and other mass media and community-based campaigns. Many choices are available, including free and commercial clinics, counseling, and more. For the vast majority of smokers, this is the most effective and cost-efficient method for quitting. Quitting smoking can be accomplished in a variety of ways, including on one’s own, with the help of a health professional, or with the aid of a quit-smoking guide. It is possible to effectively quit smoking, but sustaining that status requires assistance from others and additional measures like relapse prevention.

    C

    chemotherapy and inhalers

    (Etter, et al, 2002) explains that, Additional treatments to stop smoking, such as nicotine inhalers and chemotherapy, are also available. Smoking cessation is the most popular technique of stopping smoking, and it is also the most effective. The puffing motion of a nicotine inhaler might cause irritation of the tongue and throat. As well as causing stomach pain and headaches, it can induce coughing. In addition, the cost is considerably high. Cigarette smokers are more likely to experience side effects from chemotherapy and radiation such as infection, weariness, heart and lung difficulties, and weight loss than nonsmokers, according to the American Society for Clinical Oncology (ASCO).

    O

    Outcome of cessation of smoke are immediate benefits such as improved oxygenation and lower blood pressure, improved senses of smell and taste, improved circulation and breathing, greater energy and an improved immune response after quitting smoking. Health advantages include; risk of developing multiple primary lung cancer tumors decreases. (Cataldo, et al, 2010) remaining life expectancy has been lengthened. Patients who quit smoking after being diagnosed with lung cancer have shown to have a considerable improvement in their quality of life. primary lung tumor increased the risk of death by around 20%, but adjusted estimates showed that continuing smoking increased that risk by more than twofold. There are fewer complications following surgery than there are before. Postoperative problems are more common in smokers, whereas nonsmokers are at a lower risk. NSCLC patients who had surgery for sleeve lobotomies were studied for surgical morbidity and mortality. Postoperative complications, including infection and bronchopleural fistula, as well as morbidity and death, were significantly influenced by current smoking in the research participants.

    citation

    Research statement

    Sample size and method

    Results

    limitation

    Final summary

    Cataldo, J. K., Dubey, S., & Prochaska, J. J. (2010). Smoking cessation: an integral part of lung cancer treatment. Oncology, 78(5-6), 289-301.

    The paper reports on

    the benefits of smoking cessation for lung cancer patients

    Descriptive

    Quantitative analysis

    immediate benefits such as improved oxygenation and lower blood pressure, improved senses of smell and taste.

    Patients have a considerable improvement in their quality of life

    More study is required in order to design smoking cessation strategies that are successful and personalized.

    lung cancer patients who smoke are extremely dependent on tobacco during a life-threatening situation; study is needed to provide effective and targeted smoking cessation therapies for these patients

    Stead, L. F., Buitrago, D., Preciado, N., Sanchez, G., Hartmann‐Boyce, J., & Lancaster, T. (2013). Physician advice for smoking cessation. Cochrane database of systematic reviews, (5).

    To assess the effectiveness of advice from physicians in promoting smoking cessation

    analytical

    Randomized trials

    Preparation, intervention, and maintenance make up the three components of smoking cessation therapy

    Although more intensive therapies have an advantage over very brief interventions, simple guidance has no influence on quitting rates.

    The development of techniques to increase the frequency with which smokers are identified and offered guidance and help presents a significant challenge.

    Etter, J. F., Laszlo, E., Zellweger, J. P., Perrot, C., & Perneger, T. V. (2002). Nicotine replacement to reduce cigarette consumption in smokers who are unwilling to quit: a randomized trial. Journal of clinical psychopharmacology, 22(5), 487-495.

    To evaluate if nicotine replacement treatment, provided in a real-world setting, could reduce cigarette consumption among smokers who were unwilling to stop.

    analytical

    Randomized trials.

    Sample-20 Cigarette smokers who had no intention of quitting in 6 months

    The puffing motion of a nicotine inhaler might cause irritation of the tongue and throat.

    Cigarette smokers will experience side effects from chemotherapy and radiation such as infection

    A placebo effect was responsible for a large portion of this reduction. Treatment with nicotine to reduce smoking had no negative effects on quitting.

    It is costly to conduct tests for specific markers like anabasine or any of the other non-specific indicators seen in the blood after exposure to smoke from a cigarette.


    References

    Cataldo, J. K., Dubey, S., & Prochaska, J. J. (2010). Smoking cessation: an integral part of lung cancer treatment. Oncology, 78(5-6), 289-301.


    https://scholar.google.com/scholar?hl=en&as_sdt=0%2C5&q=Smoking+Cessation%3A+An+Integral+Part+of+Lung+Cancer+Treatment&btnG=

    Etter, J. F., Laszlo, E., Zellweger, J. P., Perrot, C., & Perneger, T. V. (2002). Nicotine replacement to reduce cigarette consumption in smokers who are unwilling to quit: a randomized trial. Journal of clinical psychopharmacology, 22(5), 487-495.

    https://journals.lww.com/psychopharmacology/Abstract/2002/10000/Nicotine_Replacement_to_Reduce_Cigarette.8.aspx

    Stead, L. F., Buitrago, D., Preciado, N., Sanchez, G., Hartmann‐Boyce, J., & Lancaster, T. (2013). Physician advice for smoking cessation. Cochrane database of systematic reviews, (5).

    https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD000165.pub4/full

    Home>Nursing homework help
    fast

     Based on the strength of the evidence from the three articles reviewed in do introduce substance abuse programs compared to no substance abuse programs reduce substance abuse within a year., decide if a practice change or a recommendation for the implementation of a practice is indicated. You will make a recommendation to change or not change current practice (“C”) to the new practice that you reviewed (“I”) based on this evidence. 

    Prepare a voice-over PowerPoint presentation summarizing the PICO question, research findings, recommendations for change/no change to practice, and rationale for the recommendation.  Limit your presentation to no more than 10 minutes and 8-10 slides that are clear, succinct, and compelling enough to convince the audience of the soundness of your recommendation. 

      • 20
      Report Issue
      Home>Social Science homework help

       Discuss your individual critical analysis of the posted article with in-text referencing to support your thoughts and ideas and with a reference list .

       

      1.      Analyze and discuss why a QI project was needed.

      2.      What initial steps were assessed by the QI team? Discuss their findings, including the data.

      3.      Why was the focus of the QI project on a specific population?

      4.      Analyze the QI model used for this project. Name and discuss an alternative QI model that could have been used in this project.

      5.      Evaluate the findings of the QI project. Were the findings relevant? How did the RNs utilize and integrate the findings into their nursing    practice?

      6.      What is your cosmic question?

      • 15
      Report Issue

      Tentative Title

      An Analysis of the Supreme Court’s Decision in Lukumi Babalu Aye v. Hialeah and How the Case Fits into the Interpretation of the Practice Clause of the First Amendment Freedom of Religion Guarantee

      Topic Description

      Practitioners of the Yoba religion, also known as Santeria, sacrifice animals, including fowls, goats and turtles as part of their rituals, after which the sacrificed animals are consumed as food. Hialeah, Fla., officials adopted an ordinance prohibiting ritual sacrifice of animals within the city limits. The church claimed that the ordinance violated its members’ constitutional freedom of religion rights. The lower courts applied the Smith doctrine, which distinguishes between religious faith and religious conduct, to the Hialeah issue.

      Purpose of Term Paper

      The researcher proposes to explore and analyze literature related to issues raised before the U.S. Supreme Court in Church of the Lukumi Babalu Aye, Inc. v. Hialeah. In the conclusion of the paper, the researcher will attempt to identify rationales the U.S Supreme Court used in its ruling and implications of the outcome.

      Value of the Study

      The researcher will arrive at a clearer understanding of the guarantee of freedom of religion – particularly the difference between belief and an action based upon faith.

      Bibliography of Tentative Sources

      Articles

      “Babalu Aye Is Not Pleased: Majoritarianism and the Erosion of Free Exercise,” 45 U. Miami L. Rev. 1061 LEXIS (May 1991).

      Colson, Charles. “The Cross and the Crown.” Chapter in Kingdoms in Conflict. New York: William Morrow & Company, Inc., 1987, 109-21.

      Lawton, Kim A. “Uncle Sam v. First Church.” Christianity Today, 7 October 1991, 25-28.

      Laycock, Douglas. “Summary and Synthesis: The Crisis in Religious Liberty,” 60 Geo. Wash. L. Rev. 841 LEXIS (March 1992).

      McConnell, Michael W. “Accommodation of Religion: An Update and a Response to the Critics,” 60 Geo. Wash. L. Rev. 685 LEXIS (March 1992).

      Pelieur, Matthew. “Commercial Speech Applications of the Lukumi Case.” Journal of Church and State 21 (Fall 1993): 294-99 in Advertising Law Anthology 17 (1993): 701-25.

      Ward, Antonio. “Santeria Case May Affect First Amendment Rights of Journalists,” American Journalism Review 19 (January 1993): 43-48.

      Cases

      Church of the Lukumi Babalu Aye, Inc. v. Hialeah, 508 U.S. 520 (1993).

      Good News Club et al. v. Milford Central School, 533 U.S. 98 (2001).

      Lyng v. Northwest Indian Cemetery Protective Assn., 485 U.S. 439 (1988).

      Oregon et al. v. Alfred L. Smith et al., 494 U.S. 872, (1990).

      Home>Nursing homework help
      fast

      Post an example of a tool you believe is an excellent patient teaching tool (either a link or as an attachment). Why do you find this tool so effective? Which principles of good teaching-learning does it follow? What principles of teaching and learning do you see that are regularly violated in your practice setting? Which are implemented well?

      Health beliefs and behaviors can affect learning and care. Describe a situation in which you encountered a barrier to care or learning due to health beliefs, behaviors, or attitudes. How did you handle the situation? How might you have done things differently? write this in 500 words APA format. need this in 14hours.

        • 10
        Report Issue

         

        Research professional health care associations, such as HIMSS and AHIMA, that address ethical standards.

        Using information from your chosen association, write at least a 1,050-word review that describes ethical standards relating to the following:

        • Electronic data access
        • Release of information
        • Reporting procedures and responsibilities
        • Staff and the organization
        • Reporting guidelines for breaches or suspected breaches
        • Proposed possible improvements in ethical standards

        Literature Review due February 26, 2022 by 2355

        1. Select a minimum of 5 primary research studies from your literature search. Articles must justify the PICOT.

        2. Critically appraise the selected articles. 

        3. Synthesize the findings of the articles to come up with a justified conclusion to your PICOT.

        4. All references and in-text citations must follow APA guidelines. 

        See rubric in Syllabus Supplement for additional information and grading guidelines.

        **No late submissions or resubmissions will be allowed. Do your best work the first time. I look forward to reading your papers.**

        Literature Review

        Virginia Nzolewane

        Stratford University

        NSG 410: Research and Evidence-Based Nursing Practice.

        12/4/2021

        Dr. Karen Benson

        Introduction

        Clinical research in nursing is conducted to investigate a specific issue. In any research, theoretical framework provides support and justification for the research problem. For this particular case, Dorothea Orem’s theory of self-care deficit serves as the theoretical framework upon which the literature review will be based. Self-care, theory of nursing systems, and the concept of self-care deficit were used to identify the need of the patients (Aga et al., 2019). In the theory of self-care, Dorothea Orem defines self-care as the daily living activities that can be done as an individual to maintain one’s well-being. In this stage the individual should be able to understand their level of functioning such as being able to be independent. This self-care is usually carried out to fulfill self-care requisites (such as universal, self-developmental and health) (Smith, 2019). A patient will be considered in self-care deficit if any of the aforementioned self-care requisites are lacking. The self-care deficit simply indicates that there is a need, and this need will necessitate the use of nursing systems to provide care. This care can either be carried out by a provider or care giver depending on the degree of the deficit the individual is presenting with. Nursing systems will also be used to evaluate care provided to measure if the goals were met.

        The research question is; Does lifestyle modification improve clinical health outcomes in hypertension management?

        The chosen population already has a deficit. This deficit is hypertension, and the plan is to educate the chosen population about the advantageous effects that lifestyle modifications has compared to pharmacological therapy in managing hypertension. Orem’s nursing process will be used to guide this research. Orem’s nursing process follows the following steps:

        · Assessment – In this step, the provider will gather the patient’s history. Within the gathered history, lifestyle habits questions will also be gathered (e.g. medication regimen compliance, diet and exercise regimen).

        · Diagnosis – The information compiled from the assessment above will help the provider arrive at a diagnosis.

        · Plan – Here, the provider comes up with a plan of action which is also known as the care plan. This plan includes the procedural tactics to achieve the goals that will be set by the patient and the provider.

        · Implementation – During this step, the plan mentioned above will be set into motion.

        · Evaluation – Finally, the entire nursing practice is evaluated. This process is also done during the implementation phase to make changes.

        In conducting this literature review, Google Scholar was used to search for articles related to this PICOT question. Specifically, this literature review aims to answer: does lifestyle modification improve clinical health outcomes in hypertension management?

        Key words used: blood pressure, hypertension, dietary therapy, physical activity, pharmacotherapy, digital therapeutics, lifestyle modification, ambulatory blood pressure, home blood pressure.

        Literature Review

        Hypertension (also known as high blood pressure) is a condition in which the pressure of the blood in the vessels is higher than normal. High blood pressure is also known as the silent killer; high blood pressure is a prevalent and dangerous condition. This condition can be known as the silent killer because many individuals with hypertension are asymptomatic until the condition progresses to a stroke, kidney failure, or heart failure (Centers for Disease Control and Prevention [CDC], 2019). This can be prevented or well managed through diet, exercise and adherence to treatment regimen. Two of the top causes of mortality in the United States are heart disease and stroke, which can be caused by uncontrolled hypertension. One out of every three adults (about 75 million people in the United Sates) has been diagnosed with hypertension and only 50% of these individuals have controlled hypertension. In 2013 alone, approximately 360,000 deaths were reported from hypertension (CDC, 2019). Therefore, 29% of adults in the United States have hypertension; men (30.2%) have slightly higher hypertension prevalence than women (27.7%). Hypertension becomes more common with the aging population; 63.1% of individuals with hypertension are aged 60 years or older, while 33.2% of adults with hypertension are in the 40-59 age group. Adults between the ages of 18-39 have a prevalence of 7.5%. (CDC, 2019). Hypertension has become a public health issue due to the increment in incidence and prevalence; with this continuous increase, it has been estimated that in 2025 one out of three people will be diagnosed with this disease (Ashoorkhani et al., 2018).

        A trial overview carried out by Ozemek et. al. (2020) sought to assess the value of exercise and diet in lowering blood pressure in patients with resistant hypertension. In this trial, a randomized sampling of one hundred forty patients with a mean age of 63 years diagnosed with resistant hypertension were separated into a group that delivered lifestyle intervention through a center-based cardiac rehabilitation facility (C-LIF) and another group that underwent standardized education and physician advice (SEPA). The DASH (Dietary Approaches to Stop Hypertension) diet was mentioned as one of the recommended food intake plans to help manage resistant hypertension. The investigation revealed that reduction in clinic systolic blood pressure was greater in patients under C-LIF compared to SEPA. 24-hours ambulatory systolic blood pressure was also reduced in C-LIF with no reported change in patients under the SEPA group. While hypertension is a condition that can vary among different people, it was shown in this study that a regulated program of diet and exercise can lower blood pressure in patients with resistant hypertension. This literature is vital in the improvement of discourse about patient education and hypertension management since it suggests ways of improving the care that the nursing service seeks to provide (Ozemek et. al., 2020).

        A descriptive cross-sectional study done in Kenya by Kimani et. al. (2020) investigated the association of lifestyle modification and pharmacological adherence among patients with hypertension in a national referral hospital. 229 patients diagnosed with primary hypertension were chosen at random for this study. The study found that respondents on antihypertensive medication that also engaged in healthy lifestyle and had proper adherence to medication had lower mean blood pressure than those only on medication. The study also showed that ageing, being female, having fast food and animal fat intake were associated with missed blood pressure targets and hypertension-related complications. Pharmacological interventions for hypertension are used in healthcare, but there is great emphasis on non-pharmacological approaches such as lifestyle modifications. Lifestyle modifications (such as diet and exercise) can be implemented to prevent hypertension in pre hypertensive patients, and these lifestyle modifications can be implemented as an adjunct therapy or primary therapy in hypertensive patients prior to drug therapy initiation. This study was limited in its cross-sectional design and by the restriction of assessing lifestyle choices (e.g., smoking, alcohol consumption) to just one point in time might have contributed to gaps in the study about the association of lifestyle modifications and hypertension management (Kimani et. al., 2020).

        Other risk factors related to hypertension were also studied in a quantitative, epidemiologic, and cross-sectional research design by Guptha. (2021). Specifically, the study examined the effect of National Institute of Health and Clinical Excellence and American Diabetes Association consensus adjusted BMI on the risk of T2DM in a representative sample of ~ 6,000 Asian Indians to narrow the knowledge gap and achieve population specificity. It was shown that both lifestyle changes and medical treatment were beneficial and had a significant effect on hypertension management.  This study fills in the knowledge gaps about reducing systolic and diastolic BP and the decrease of cardiovascular risk by non-pharmacological (lifestyle measures) as well as pharmacological means. Like the previous cross-sectional study, this research was also limited to this design in which hidden biases might have emerged and confounded the variables and its results in the study. The study did not also include respondents from rural areas, which is where more than half of the people in India reside, possibly limiting the extrapolation of results to only urban regions of India and risking misrepresentation of the target population (Guptha., 2021).

        To further expound the effect of nonpharmacologic treatment, a Bayesian network meta-analysis by Fu et. al. (2020) was reviewed and showed that nonpharmacologic interventions, including dietary approaches, are a cornerstone for the prevention and treatment of hypertension. A total of 60,166 articles were identified in the initial systematic search, and 888 potentially eligible articles were narrowed down and retrieved as full text. Overall, 120 articles (corresponding to 126 randomized controlled trials) with 14,923 participants met the inclusion criteria and were included in the network meta‐analysis. This study affirms that DASH is a potent effector in modulating dietary changes and decisions of patients with hypertension. However, the study reported only the effectiveness of nonpharmacologic interventions in lowering BP, lacking secondary end points such as rate of BP control, incidence of hypertension, and mortality due to complications of hypertension. In addition, upon further review of this meta-analysis, it was found that only 8 interventions were only directly compared with usual care. Smoking as a lifestyle risk factor was excluded from this study because existing randomized controlled trials on smoking cessation in patients with hypertension or prehypertension were not truly implemented. This network meta‐analysis showed that, among 22 nonpharmacologic interventions, DASH was the most effective intervention in lowering BP for adults with prehypertension to established hypertension. Aerobic exercise, isometric training, low‐sodium and high‐potassium salt, comprehensive lifestyle modification, breathing control, meditation, and low‐calorie diet also have obvious effects in lowering BP. Moreover, the findings suggest that salt restriction be used for lowering BP, especially in patients with hypertension (Fu et. al., 2020).

        Rounding out this literature review is a randomized, open-label HERB-DH1 study by Kario et. al. (2021) which showed that the HERB-DH1 pivotal study showed the superiority of digital therapeutics compared with standard lifestyle modification alone to reduce 24-h ambulatory, home, and office BPs in the absence of antihypertensive medications. All 390 respondents were 20-64 years old (mean age range of 52-52.4)) and diagnosed with essential hypertension were randomly grouped into the digital therapeutics group and the control group. Digital therapeutics is a novel approach to managing non-pharmacological treatment of hypertension. The HERB system helps the user to make lifestyle modifications to reduce BP by the use of an interactive smartphone app. For the duration of the study, pharmacological interventions were prohibited and discouraged with physician monitoring so as to avoid confounding the results. Being a pilot study, the research was limited to the variables that could be studied and numerous knowledge gaps were identified. The time period of monitoring BP change through non-pharmacological methods was also inadequate (12 weeks) to properly determine whether the lifestyle modifications were able to provide significant change to the patient’s blood pressure (Kario et. al., 2021).

        Conclusion

        Conducting this literature review gave me the opportunity to peruse various sources for the evaluation of non-pharmaceutical methods in managing hypertension among patients 40-70 years of age. I realized that the worldwide disease burden of hypertension is too big to ignore and has become a significant public health issue over the decades. With more and more people becoming obese and acquiring hypertension and hypertension-related complications, it is imperative to study and research about the protocols that can be put in place to mitigate this condition. It must also be noted that medications alone will not have a significant effect. The patient must be able to make health decisions on their diet, exercise, and other lifestyle choices by being well-informed, and this patient education begins with the nurse at the helm of the care team as a patient advocate.

        Better designed researches must also be conducted to fill in the gaps of knowledge established by prior researches. The studies reviewed here had similarities other than the inclusion criteria of having a respondent diagnosed with hypertension, the studies also were designed to study multiple therapeutic approaches to gain a better insight. Overall, the weaknesses of the studies, other than the ones detailed in the literature review above, was only prominent in descriptive and cross-sectional studies, as the variation in research variables can be significant enough to affect the results of the study. The level of scientific evidence must also be taken into account when designing a research study, wherein the most apt and highest yield study design must be chosen.

        References

        Ademe, S., Aga, F., & Gela, D. (2019). Hypertension self-care practice and associated factors among patients in public health facilities of Dessie town, Ethiopia. BMC health services research, 19(1), 1-9.

        Fu, J., Liu, Y., Zhang, L., Zhou, L., Li, D., Quan, H., … & Zhao, Y. (2020). Nonpharmacologic interventions for reducing blood pressure in adults with prehypertension to established hypertension. Journal of the American Heart Association, 9(19), e016804.

        Guptha, L. S. (2021). A Cross-Sectional Epidemiology Study of the Relationships between Body Mass Index and the Risk of Diabetes, and Diabetes and the QRISK2 10-Year Cardiovascular Risk Score Using India Heart Watch Data (Doctoral dissertation, Trident University International).

        Hypertension. (2019). Retrieved from https://www.cdc.gov/bloodpressure/index.html

        Kario, K., Nomura, A., Harada, N., Okura, A., Nakagawa, K., Tanigawa, T., & Hida, E. (2021). Efficacy of a digital therapeutics system in the management of essential hypertension: the HERB-DH1 pivotal trial. European heart journal, 42(40), 4111-4122.

        Kimani S, Mirie W, Chege M, et al (2020) Association of lifestyle modification and pharmacological adherence on blood pressure control among patients with hypertension at Kenyatta National Hospital, Kenya: a cross-sectional study BMJ Open 2019;9:e023995. doi: 10.1136/bmjopen-2018-023995

        Ozemek, C., Tiwari, S., Sabbahi, A., Carbone, S., & Lavie, C. J. (2020). Impact of therapeutic lifestyle changes in resistant hypertension. Progress in cardiovascular diseases, 63(1), 4-9.

        Smith, M. C. (2019). Nursing theories and nursing practice. FA Davis.

        Literature Review Sample 1.docx

        2

        11

        Patient Violence Against Nursing Staff and De-Escalation Courses: Literature Review

        Name

        NSG 410 Research and Evidence- Based Nursing Practice

        Dr. Coffin

        Patient Violence Against Nursing Staff and De-Escalation Courses: Literature Review

        Overview and Introduction

        Patient violence against nursing staff is an ongoing, and rising, issue in the healthcare field not just in the U.S., but worldwide. According to The Joint Commission (2018), workplace violence (WPV) occurs four times more in nurses in hospital settings than any other worker in the private sector. Nurses working in emergency departments are at the greatest risk of verbal and/or physical assault than any other unit of nursing due in part to being the first point of contact with the patient from the outside (Wong et al., 2015). That being said, WPV still occurs in all nursing fields putting each nurse working bedside at risk. Using meticulous technique, a literature review was conducted using primary sources in the span of several weeks. Search terms such as “violence in nursing”, “workplace violence”, “occurrences”, and “de-escalation training” were combined and inputted into databases such as ProQuest, National Institutes of Health, and CINAHL with additional search terms applied when needed for clarification. The articles that will be discussed in this review were chosen because they are primary sources that moved the discussion forward on solutions to reduce patient violence against nurses. Knowles’ Adult Learning Theory was the theoretical framework used to guide this research with the understanding that adult learning is mainly self-directed and self- motivated, so in order to be able to implement successful education programs, such as that of this intervention, this understanding must be acknowledged (Casey, 2019). Comment by Rebecca Coffin: The problem is clearly presented and data is provided to show the magnitude of the problem Comment by Rebecca Coffin: Search terms are provided Comment by Rebecca Coffin: No need to use a theory to guide your paper, but you are welcome to do so if you wish Comment by Rebecca Coffin [2]: Great introduction!

        Clinical Question

        The clinical research question in focus for this literature review is as follows: Among nursing staff in acute hospital units, what is the effect of de-escalation training courses in reducing the number of violent events compared with learning de-escalation on the job, within 12 months of implementation. Comment by Rebecca Coffin [2]: PICOT

        Appraisal of Articles

        With Knowles’ Adult Learning Theory in mind, articles were chosen that exemplified the integration of adult learning into their interventions. In the article “Management of Aggressive Patients: Results of an Educational Program for Nurses in Non- Psychiatric Settings,” by Casey (2019), a non- experimental one-group, pre-post test design was used to evaluate the effectiveness of an education program that utilized multiple teaching strategies. The study recruited 36 registered nurses from a neurological unit in an adult hospital in southern United States. The program was delivered in a hybrid format over 6 weeks that utilized online presentations as well as in person classroom sessions. In line with the theoretical framework, the researchers utilized case studies to foster critical thinking, face to face role play was used demonstrate and build up de-escalation techniques, and group reflections were used to collectively bring together what was learned. Data was collected using self- reported Likert scale questionnaires that were validated by experts in emergency and psychiatric nursing. Analysis of the data concluded significant improvement in demonstration of preparedness and increased confidence in managing aggressive behaviors through the use of the designed educational program. Comment by Rebecca Coffin [2]: Don’t need to include the title of the article in APA style

        The major limitation of the study was the small sample size not being significant enough to be generalizable. There was also time constraints limiting the amount of time for learning but was necessary in this study to feasibly allow maximum number of participants due to having to work around shift schedules. The researcher in this study recommends expanding similar interventions into other acute hospital units.

        The article, “Reducing conflict and containment rates on acute psychiatric wards: The Safewards cluster randomized controlled trial” by Bowers et al. (2015) implemented 10 carefully selected interventions into a clustered randomized control trial to study its effects on rates of conflict and containment. The study came about from the understanding that there is a need for RCT’s in this topic. The study comprised of 15 psychiatric wards surrounding central London with inclusion criteria being acute psychiatric inpatient wards and were excluded if the wards had any major changes coming up in the course of the 18-month study, if they didn’t have a permanent nurse manager on post, and if the staff vacancy rate was greater than 30%. With these criteria put in place, nurses in the included wards chose to participate bringing the total number of participants to 564 (88% of the potential total). The confidence in this sample size was confirmed in each category with a power analysis. Baseline data was collected for 8 weeks, then participants had 8 weeks to implement the trained interventions, and 8 weeks additional were for observation of the implementation. This study was double blind in that both researchers and participants were unaware of which was the control and which was the intervention. Wards were visited 2-3 times a week by researchers who delivered and collected questionnaires and answered any questions about the interventions in order to ensure strong reliability. Results showed the interventions implemented in the Safewards interventions were significantly effective in reducing patient conflict and containment. Given that the primary source of data collection came from questionnaires, the main limitation of this study was missing data from unsubmitted questionnaires by charge nurses working the participating shifts. After accounting for these deficits however, they concluded that the missing data was not significant enough to shift the findings. The second limitation and recommendation for future research was that the study length was too short of a time period to really see significant change after implementation. Comment by Rebecca Coffin: Good critique! Look for whether a power analysis was performed in quantitative studies Comment by Rebecca Coffin [2]: What effect does this have on the study? Is this a good thing to do?

        This study understood that there was a lack of quantitative research on violence against nurses in the form of randomized control trials, so the research design itself was created with the hopes of being the trailblazers for future research to continue RCT’s in the study of this concept. By explicitly highlighting each limitation set forth in their study, they were able to use their limitations to pave the path for future research.

        In the study “Educational and Managerial Policy Making to Reduce Workplace Violence Against Nurses: An Action Research Study” Hemati- Esmaeili et al. (2018), look beyond education at the bedside nurse level to go a step up the ladder to include managerial interventions. This study took place in Iran but many issues presented in this study are parallel universally to many other hospital settings. With a sample size of 44 nurses confirmed by a p value test, a workplace violence prevention program was developed in conjunction with the development of a new nursing position called the violence prevention nurse, whose role was to screen patients and their families upon arrival to the hospital for potentially aggressive behaviors. Careful analysis using SPSS software analyzed the results of the self-report surveys and focus groups and concluded that the implementation of the program significantly reduced fear associated with these violent events because the nurses felt more prepared to handle them. This study went a step further than the previously discussed studies by including a managerial intervention where a protocol was put in place of how to take care of staff who had been attacked. Comment by Rebecca Coffin [2]: Good point to highlight!

        This study did an excellent job of highlighting the need for interventions that are individualized to each unique unit. They explained that many aspects of the design, such as altering the questionnaire scales used to better suit Iranian culture, was a big step in improving fidelity in the study because the nurses could answer more accurately. Unique to this study and also not included in the previously mentioned studies, was a follow up survey four months after conclusion of the study. Researchers could still see strong evidence of the interventions being implemented. Follow up studies should be included in future research in this topic to measure long term effects. Comment by Rebecca Coffin [2]: That is a good thing to do to check how long the effect lasts

        The study “Coordinating a Team Response to Behavioral Emergencies in the Emergency Department: A Simulation- Enhanced Interprofessional Curriculum further enhance the findings from all the previously mentioned studies by integrating teamwork into simulation scenarios using larger sample sizes. Wong et al. (2015) hoped that through implementation of an interprofessional curriculum into simulation enhanced education, teamwork and staff attitudes toward patient violence would improve. Ten 3-hour simulation sessions were conducted for this study. In the simulation, formal roles were predetermined, meaning each member of the healthcare team knew exactly what their roles were immediately once a violent event was occurring. The study recruited 162 ED staff members. Surveys used to collect data were published from a British nursing education group that showed reliability and internal validity. Data collected was reflective of participant’s changing attitudes through the duration of the course. Risk for bias in response was present though in that evaluators of the program were in leadership positions within the participating department, which may have confounded responses with staff members answering in responses favorable to the evaluators. As was the main theme with all the studies discussed thus far, the main limitation of the study was time constraints and lack of longitudinal data. Comment by Rebecca Coffin: Another great critique!

        Given the emotional magnitude of this research topic, it was necessary to include a qualitative study into this review to increase the magnitude of its relevance to the nursing profession and place further emphasis that research in this field is what the people directly involved want. The qualitative phenomenological study “The Patient Care Paradox: An Interprofessional Qualitative Study of Agitated Patient Care in the Emergency Department” by Wong et al. (2016), took their research further from the previously discussed study to look at the experience of these healthcare workers to provide a broader perspective of ED patient violence. Convenience, but purposive, sampling was used to recruit participants. This study took careful measures to reduce bias in all aspects of the study. For example to balance out and decrease bias during data collection, the research team consisted of 2 board certified ED physicians, but also 2 nurses working outside of the ED (palliative and midwifery) so as to maintain an insider/ outsider approach and to bracket potential personal biases which could have skewed the data collection. In the research design, 1 member of the research team with no prior relationships to any of the participants was trained for qualitative data collection while another member assisted in equipment setup and took field notes. The interview process was standardized and data was cross-checked. Interview responses and focus group discussions were all recorded, transcribed, and later professionally transcribed by a third party. In this study, data saturation was reached at 31 participants. Comment by Rebecca Coffin: Spell out “two” Comment by Rebecca Coffin: Here also, “two” should be spelled out Comment by Rebecca Coffin [2]: Spell out numbers <10 per APA style Comment by Rebecca Coffin [2]: Good!

        Three themes were discovered as a result of these interviews. The first is the patient care paradox: that in the process of providing high- quality care for these potentially aggressive patients, staff are putting themselves at greater risk of a violent incident, and finding a balance is not easy. Under this theme, direct quotes were included that talked about injuries many of the participants sustained as a result of trying to provide quality care. The second theme was that teamwork is key to resolution of a violent situation, however, pre-existing conflicts up the linear ladder of command make it hard to fluidly work as a team. In this particular hospital, quotes were included that talked about how techs can’t do anything to de-escalate a situation unless the nurse is involved, and the nurse can’t prophylactically prevent a violent incident unless he/she gets orders from a doctor, and it causes delay in action when not all members are on the same page. The third theme was environmental factors that further exacerbate aggressive behaviors such as lack of privacy, volume of people. The main limitation of this study is that while data saturation was reached, this data may not be generalizable to all ED’s because it was conducted in a heavy volume, urban ED in New York City. Researchers also stated that descriptions of patient population were reliant on descriptions from participants and not confirmed with demographic statistical data, thus increasing the likelihood of personal and recall bias. Comment by Rebecca Coffin [2]: Fantastic review of the articles! The articles were relevant to the PICOT and you captured all the highlights

        Conclusion

        A literature review was conducted using five primary sources to examine the effect of de-escalation courses and interventions on patient violence against nursing staff in acute hospital units. Across each article presented in this literature review was the same recurring theme: change needs to occur to decrease the rate of patient violence against nurses and healthcare staff. The articles in review were not limited to the United States to allow a comparison of occurrence of patient violence worldwide. The similarities in research topic of each of these articles is enough to attest to the ongoing need for a long-lasting intervention. Each article highlighted that this is a significant problem that is only getting worse with time. Each article was able to recognize that any intervention showed improvements than no intervention. Comment by Rebecca Coffin [2]: Was there one intervention that was better than others? Why or why not?

        Limitations encountered in the search for literature included a saturation of studies conducted in emergency departments and psychiatric wards. The study by Casey (2019) was conducted in an adult neurological unit but even in their discussion they explained how they borrowed scales more suited for emergency departments. Another limitation noted in these studies was that no matter what statistical data is published on rates of workplace violence in nursing, the number is always higher because there is always the incidences that don’t get reported. One strength of these studies was their use of self-report data collection to foster an outlet for these nurses and healthcare workers to have their thoughts heard that they might otherwise have been too scared to report for fear of job security or backlash. The limitation of time led to many gaps and inconsistencies in the results of a number of these studies. For example, the articles by Wong(year) and Bowers (year)both explained how implementing a new protocol for an entire hospital unit is a very time- consuming task in and of itself. They both explained how by the time their interventions were taught at the level suitable to continue on with the study, weeks had already gone by. In both discussions, it was highlighted that longer time for data collection would have allowed more significant results. Research must continue on this topic for the improvement of the nursing field as a whole. Comment by Rebecca Coffin [2]: Not surprising, I’m sure! Comment by Rebecca Coffin [2]: Yes but what do we know about the limitations of self-report? Comment by Rebecca Coffin [2]: Nicely done! I think you could have had a more definitive conclusion, but you did a great job in comparing / contrasting the studies overall


        References Comment by Rebecca Coffin: References are formatted per APA guidelines

        Bowers, L., James, K., Quirk, A., Simpson, A., Stewart, D., & Hodsoll, J. (2015). Reducing conflict and containment rates on acute psychiatric wards: The Safewards cluster randomized controlled trial. International Journal of Nursing Studies, 52(9), 1412-1422.

        Casey, C. (2019). Management of aggressive patients: Results of an educational program for nurses in non-psychiatric settings. MEDSURG Nursing, 28(1), 9-21.

        Hemati-Esmaeili, M., Heshmati-Nabavi, F., Pouresmail, Z., Mazlom, S., & Reihani, H. (2018). Educational and managerial policy making to reduce workplace violence against nurses: An action research study. Iranian Journal of Nursing and Midwifery Research, 23(6), 478–485. https://doi.org/10.4103/ijnmr.IJNMR_77_17

        The Joint Commission. (2018). Physical and verbal violence against health care workers. Sentinel Event Alert.

        Wong, A. H., Wing, L., Weiss, B., & Gang, M. (2015). Coordinating a team response to behavioral emergencies in the emergency department: A simulation- enhanced interprofessional curriculum. The Western Journal of Emergency Medicine, 16(6), 859-865.  https://doi.org/10.5811/westjem.2015.8.26220

        Wong, A. H., Combellick, J., Wispelwey, B.A., Squires, A., & Gang, M. (2016). The patient care paradox: An interprofessional qualitative study of agitated patient care in the emergency department. Academic Emergency Medicine, 24(2), 226-235. https://doi.org/10.1111/acem.13117

        Literature Review Sample 2.docx

        Running Head: LITERATURE REVIEW 1

        LITERATURE REVIEW 6

        Literature Review

        Stratford University

        Introduction Comment by Rebecca Coffin: Good introduction, used a statistic to support why hand-washing is important in school-age children. This could be more powerful in grabbing the reader’s attention with additional statistics and better describing the relationship between the variables.

        Keeping the hands clean and proper handwashing, are some of the most important steps to take to avoid getting sick and spreading germs to others (CDC, 2017). Keeping that in mind, absenteeism is a growing problem among school-aged children, with approximately 75% of all school absences attributed to illness (Lau et al., 2013). Hand washing is of great importance in this matter, but the role of instruction is far less obvious. The purpose of this literature review, is to evaluate five research articles that focus on the importance of hand washing education, and its relation to illness-related absenteeism among school-age children. My article search was done by use of Medline/PubMed Resources and ProQuest, using keywords, hand hygiene, illness-related absenteeism, and childhood illness prevention. Comment by Rebecca Coffin: Good!

        Clinical Question

        In District of Columbia Public School students, grades K-4, what is the effect of a comprehensive handwashing program (handwashing education and use of hand sanitizer), compared with no comprehensive handwashing program, on the rate of illness-related absenteeism, within 3 months.

        Appraisal of Articles

        The first article, “Effectiveness of Hand Hygiene Intervention in Reducing Illness Absence Among Children in Educational Settings, by Wilmott et al., is a systematic review and meta-analysis study, done to establish the effectiveness of handwashing in reducing absence among school-aged children. Specifically, the study took an in depth look at the spread of respiratory tract and gastrointestinal infections, and their frequency among children and/or staff in the educational setting. Interventions in this study, consisted of education with a hand hygiene component, which involved eighteen cluster RCT’s of 13 school-based and 5 child day care facilities (Wilmott et al., 2015). Results of the teaching suggested that interventions may reduce children’s absences, although randomization was inadequate. The study was not well executed or reported, despite an updated existing systematic review, which found that identifying new studies relating evidence of the effect of hand hygiene interventions on absenteeism, would need to be more robust (Wilmott et al., 2015). Comment by Rebecca Coffin [2]: No systematic reviews allowed in this assignment Comment by Rebecca Coffin [2]: What does this mean?

        The second article, “The Impact of Common Infections on School Absenteeism During an Academic Year,” by Azor-Martinez et al., is a randomized, controlled open study, which focused on the assessment of the impact of infections on school absenteeism, and their reduction with a handwashing program using hand sanitizer (Azor-Martinez, 2014). The study, which took place over an 8-month time frame, consisted of an experimental group of 4-12-year-olds, who washed hands with soap and water, complemented with hand sanitizer. There was also a control group that followed usual handwashing protocol. It was found that the percentage of missed days due to upper respiratory infections and GI infections, were significantly lower in the experimental group, during a flu period (Azor-Martinez, 2014). Researchers determined that this approach was effective, due to full participation of students and staff. Comment by Rebecca Coffin: Don’t need to refer to article by the title of the article. Just follow APA and cite the authors and date.

        The third article, “Comparative efficacy of a simplified handwashing program for improvement in hand hygiene and reduction of school absenteeism among children with intellectual disability,” by Lee et al., is a quasi-experimental study, which purpose is to test the feasibility and sustainability of a simplified 5-step handwashing technique, to measure the hand hygiene outcome for students with mild intellectual disability. An intervention group of 20 students underwent pre and post testing using available social learning factors, a multimedia approach, and fluorescent stain rating tests to assess handwashing quality. Results from the intervention group, showed that there was significant increase in the rating of handwashing quality in both hands of each student (Lee et al., 2015). Students in this study showed better performance in simplified handwashing techniques, and experienced lower absenteeism than using usual practice (Lee et al., 2015). Comment by Rebecca Coffin: Where’s the date!?!? Comment by Rebecca Coffin [2]: What type of testing?

        The fourth article, “Effect Evaluation of a Randomized Trial to Reduce Infectious Illness and Illness-related Absenteeism Among School children: The Hi Five Study,” by Denbaek et al., evaluates whether a school-based multicomponent intervention would improve handwashing among schoolchildren, and succeed in reducing infectious illness and illness-related absenteeism in schools (Denbaek et al., 2018). The multicomponent intervention used in this study, is called The Hi Five study, a three-armed cluster-randomized controlled trial. It involved 43 randomly selected schools in Denmark (half control, half intervention), in which parents were educated and surveyed via text message, regarding proper handwashing. A questionnaire was also administered to school children, regarding handwashing practices at home and school (Denbaek et al., 2018). Mandatory daily handwashing was also implemented before lunch. A follow-up showed that intervention schools did not differ from control schools, in number of illness days, and that the multicomponent intervention achieved no difference in the number of illness day, illness episodes, or illness-related absences among children (Denbaek et al., 2018). Comment by Rebecca Coffin [2]: What type of questionnaire? Did it demonstrate validity/reliability?

        The fifth article is, “Hand hygiene instruction decreases illness-related absenteeism in elementary school: a prospective cohort study,” by Lau et al. The purpose of this study was to compare absenteeism rates among elementary students, who were given access to hand hygiene facilities versus being given both access and short repetitive instruction (Lau et al., 2013). During one academic year, students in an intervention group and control group, were systematically assigned. Intervention students were given short repetitive instruction in hand washing every 2 months, where the control was only given access to hand washing facilities (Lau et al., 2013). Percentage of absent days were calculated, and bivariate analyses were performed to compare percent absent days of students given access to hand hygiene facilities, versus those given instruction and access (Lau et al., 2013). Participants were fully compliant, and results showed that total absent day and illness-related absences were significantly lower in the group receiving short instruction and access (Lau et al., 2013). Comment by Rebecca Coffin [2]: These summaries are succinct, but there is not much analysis/critique going on here

        Conclusion

        Each of the articles that I have listed were similar, in that they are primary sources, had one common goal, to factor in the importance of proper handwashing, through education and active participation, to lower the rate of illness-related absenteeism among school-age children. All but one of the studies consisted of randomization sampling, which was “Comparative efficacy of a simplified handwashing program for improvement in hand hygiene and reduction of school absenteeism among children with intellectual disability.” The only inconsistencies present are with the study titled, “Effectiveness of hand hygiene interventions in reducing illness absence among children in educational settings.” This study was not generally well executed or reported, due to the young age of some of the participants, lack of cooperation, and quality issues including small numbers of clusters/participants, which resulted in inadequate randomization (Wilmott et al., 2015). Comment by Rebecca Coffin: Don’t use the title of the article when referring to it – that does not follow APA style. Use the author name and year. Comment by Rebecca Coffin: Where is the answer to the question? You should be attempting to answer the question in this section by analyzing and synthesizing the strengths and weakness of the articles that were previously described. This section is worth 25 points, so make sure the content reflects that.

        References
        Azor-Martinez, Gonzalez-Jimenez, Seijas-Vasquez, Carrascosa, & Santisteban-Martinez. (2014). The Impact of Common Infections on School Absenteeism During an Academic Year. American Journal of Infection Control, 632-637.
        Centers for Disease Control and Prevention. (2017). Clean Hands Count for Safe Healthcare. Retrieved from Centers for Disease Control and Prevention: https://www.cdc.gov/features/handhygiene/index.html
        Denbaek, Andersen, Bomnesen, Laursen, & Johansen. (2018). Effect Evaluaion of a Randomized Trial to Reduce Infectious Illness and Illness-related Absenteeism Among Schoolchildren: The Hi Five Study. Pediatric Infectious Disease Journal.
        Lau, Springston, Sohn, Mason, Gadola, Damitz, & Gupta. (2013). Hand Hygiene Instruction Decreases illness-related Absenteeism in Elementary Schools: A Prospective Cohort Study. BMC Pediatrics.
        Lee, Leung, Tong, Chen, & Lee, H. (2015). Comparative Efficacy of a Simplified Handwashing Program for Improvement in Hand Hygiene and Reduction of School Absenteeism among Children with Intellectual Disability. American Journal of Infection Control, 907-912.
        Wilmott, Nicholson, Busse, MacArthur, Brooker, & Campbell. (2015). Effectiveness of Hand Hygiene Intervention in Reducing Illness Absence Among Children in Educational Settings. BMJ Journal: Archives of Disease in Childhood.

        July-August 2013 • Vol. 22/No. 4246

        Kimberly Foisy, MSN, RN, CMSRN, is Clinical Educator/Administrative Nursing Supervisor,
        Orthopedic-Neurological Medical/Surgical Unit, North Shore Medical Center (NSMC), Salem
        Hospital, an affiliate of Partners Healthcare System Inc.; and Assistant Professor, Massachusetts
        College of Pharmacy and Health Sciences, School of Nursing, Boston, MA.

        Acknowledgment: The author gratefully acknowledges Kathy Clune, MSN, RN, Nurse Manager,
        Phippen 6 and 7; and Taryn Bailey, MSN, RN-BC, Executive Director, Professional Practice and
        Patient Education Services, for their advice and guidance in the development of this article.

        Thou Shalt Not Fall! Decreasing Falls
        In the Postoperative Orthopedic

        Patient with a Femoral Nerve Block

        N
        orth Shore Medical Center
        (NSMC), Salem Hospital, an
        affiliate of Partners Health –

        care System Inc., is a 250-bed acute
        care teaching hospital located in
        Salem, MA, near Boston. The hospital
        serves a diverse patient population
        with 12,000 inpatient admissions per
        year. The hospital’s 32-bed orthope-
        dic-neurologic inpatient unit, which
        is split between the 6th and 7th
        floors of the Phippen Building, has
        an average daily census of 30
        patients. Unit leadership includes a
        nurse manager, clinical educator,
        unit coordinator, and one day-shift
        charge nurse assigned to both floors.
        Average daily staffing consists of
        three nurses, two nursing assistants,
        and a service associate for each 16-
        bed unit; staff can be assigned to
        either floor.

        Improvement Needs
        Decreasing patient falls is a

        patient safety priority for direct-care
        nurses. Many regulatory and govern-
        mental agencies, such as the Centers
        for Medicare & Medicaid Services
        (CMS), have set standards and pay-
        ment incentives to reduce or elimi-
        nate falls in the health care setting.
        For example, CMS (2011) no longer
        reimburses for hospitalization if a
        patient has an injury as a result of an
        inpatient fall. Some health care
        providers suggest falls cannot be
        avoided (Muraskin, Conrad, Zheng,
        Morey, & Enneking, 2007). However,
        staff members for the involved units
        at NSMC were determined to count-
        er this view by taking action to
        address a recent increase in patient
        falls on the unit.

        Phippen 6 and 7 house postoper-
        ative orthopedic and neurological

        surgical patients. Each floor has 16
        private beds. A group of multidisci-
        plinary professionals and unlicensed
        staff from the two units convened to
        form a team under the Transitioning
        Care at the Bedside (TCAB) model
        (Rutherford, Moen, & Taylor, 2009).
        The team set a goal to eliminate falls
        on the unit and started analyzing
        falls data to determine the rate and
        cause of falls that were occurring.
        Data revealed as many as three falls
        per month associated with femoral
        nerve blocks (FNBs), with two
        patients sustaining injury from
        January to July 2009. The unit had a
        fall rate of 5.2 per 1,000 patient days,
        compared with a fall rate of 3.43 per
        1,000 patient days for the facility.
        Further data analysis showed 5 of 30
        falls reported during that time
        occurred in patients with a femoral
        nerve block in place following knee
        arthroplasty.

        A process flow analysis revealed
        the nursing practice protocol recent-
        ly had been replaced by a standard
        computerized nursing order set that
        did not include assessment parame-

        ters for the patient or a plan of care.
        Furthermore, the signs at the head of
        the patients’ beds stating “Fall Risk
        Femoral-Nerve Block” were being
        removed as soon as the FNB was dis-
        continued. A learning needs assess-
        ment demonstrated nursing assis-
        tants did not have adequate knowl-
        edge of the definition, purpose, and
        precautions needed in caring for a
        patient with a current or recently
        discontinued femoral nerve block. In
        addition, patients and families were
        not aware of the safety risks needed
        during and after the use of a contin-
        uous femoral nerve block.

        Literature Review
        Two searches of the CINAHL data-

        base were performed to identify best
        practices (June 2009; May 2011) for
        literature of the preceding 6 years.
        The terms searched included femoral
        nerve block, falls, and orthopedic sur-
        gery. The search revealed no pub-
        lished nursing literature that demon-
        strated a decrease in falls in persons
        with femoral nerve blocks after an

        Advanced PracticeAdvanced Practice

        Kimberly Foisy

        A Transforming Care at the Bedside model was used to decrease
        falls in the femoral nerve block (FNB) patient population on a 32-
        bed orthopedic/neurologic unit in a community hospital setting.
        A multifaceted, strategic practice and educational bundle was
        implemented, resulting in a 75% decrease in falls among patients
        with FNB.

        July-August 2013 • Vol. 22/No. 4 247

        educational intervention was imple-
        mented to nursing staff. Results of
        two medical studies are described in
        the following paragraphs.

        Sharman, Iorio, Specht, Davies-
        Lepie, and Healy (2010) reported
        patients with a FNB have a shorter
        length of stay. According to these
        authors, patients ambulate earlier as
        a result of the comfort maintained
        with the block. A large percentage of
        postoperative falls among this group
        of patients have quadriceps weak-
        ness as a contributing factor.

        Continuous FNB provides effec-
        tive pain management as an anal-
        gesic adjunct to other modalities for
        orthopedic patients. A FNB reduces
        the required doses of general anes-
        thetic agents and hence their side
        effects, including nausea, vomiting,
        drowsiness, and respiratory depres-
        sion. The FNB also confers superior
        pain management, decreases opioid
        requirements, and enables earlier
        ambulation and hospital discharge
        (Atkinson, 2008). The use of FNB
        with general anesthesia also places
        the patient at a higher risk for falls.

        A continuous FNB is used as an
        anesthetic. A catheter is placed just
        below the skin surface, next to the
        femoral nerve. The catheter coats the
        nerve with anesthetic, blocking
        transmission of neuronal messages
        and creating a feeling of localized
        numbness for the patient (Kasibhatia
        & Russon, 2009). This block allows
        the patient to achieve more effective
        pain management. The block does
        not alleviate the pain on the posteri-
        or portion of the knee. An adjunct
        therapy, such as patient-controlled
        analgesia, often is prescribed for this
        reason. Because the block causes a
        weakness of the quadriceps muscle,
        the patient needs assistance with
        every transfer (Atkinson, 2008).

        One of the cases analyzed by the
        team involved a patient who was
        ambulating with a nursing assistant.
        The continuous femoral nerve block
        had been discontinued 2 hours earli-
        er. The patient’s knee buckled, and
        he proceeded to fall to the floor. The
        nursing assistant hit the door and
        sustained a minor back injury. The
        patient’s knee wound opened as a
        result of the fall, requiring minor
        suturing. Fortunately, the patient’s

        length of stay did not increase as a
        result of this fall.

        Continuous Quality
        Improvement Model

        After reviewing the data, the team
        developed a multifaceted plan to
        educate unit staff on the safety and
        care of patients with femoral nerve
        block, as well as standardize the
        process for patient care following
        femoral nerve block. The Nerve
        Block Bundle included developing
        and implementing a:
        1. Patient and family education

        sheet to engage patients in their
        care (see Figure 1).

        2. Revised nursing protocol to
        standardize the process for care.

        3. Nursing education plan.
        4. Fall prevention signage specific

        to this population (see Figures 2
        & 3).

        5. Tip sheet for unlicensed assistive
        personnel (UAP) to reinforce the
        care and safety needs of the
        patient with a FNB (see Figure 4).

        The education plan and bundle
        were presented at the NSMC Nursing
        Professional Practice Council, ac –

        cepted into practice, and imple-
        mented August-October 2009.

        Patient/Family Education
        Sheet

        Patient and family education are
        vital in preventing falls (Agency for
        Healthcare Research and Quality,
        2010). The patient/family education
        sheet (see Figure 1) includes informa-
        tion related to pain management,
        duration of the femoral nerve block,
        sensation of the lower extremity,
        and safety guidelines to reinforce the
        patient’s need to call for assistance to
        get out of bed.

        Nursing Protocol
        Sharma and co-authors (2010) rec-

        ommended hospitals develop proto-
        cols addressing decreased quadriceps
        function as a result of a continuous
        FNB. Prolonged nerve blockade can
        last up to 30 hours after termination
        of the continuous femoral nerve
        block (Atkinson, 2008). This study
        recommended the implementation
        of a postoperative evaluation that
        included proprioceptive function.

        FIGURE 1.
        Femoral Nerve Block Patient Information Sheet

        • The femoral nerve block is a regional anesthetic technique used in con-
        junction with general anesthesia for pain relief.

        • It is an effective block that provides both safe and excellent surgical
        anesthesia and postoperative pain control.

        • Your leg will feel numb, but you can still move your leg
        • You will have little or no pain in the front of your leg or knee. However,

        you will probably have some discomfort behind your knee. That is
        expected.

        • Remember to discuss your pain plan with each nurse.
        • REMEMBER: Ring your call bell for assistance.
        • You MUST NOT get out of the bed or chair, or off the commode without

        assistance.
        • Your therapist and/or nurse will instruct you on the safest ways to move.
        • The numbness and weakness from the block usually lasts 8-20 hours

        and occasionally more than 24 hours once it is removed from your
        groin.

        • As the block begins to wear off, you should start your pain medicine that
        was prescribed by the surgeon. REMEMBER: Ask the nurse for your
        pain medication. The nurse will be offering you pain medication, but you
        need to ask as well.

        Thou Shalt Not Fall! Decreasing Falls in the Postoperative Orthopedic Patient with a Femoral Nerve Block

        July-August 2013 • Vol. 22/No. 4248

        Based upon this evidence, a nurs-
        ing protocol was written to include
        the following:
        1. Assess the sensory, motor, and

        vascular condition of the
        extremity every 4 hours during
        and after removal of the femoral
        nerve block until the patient
        obtains full sensation and motor
        function returns.

        2. Maintain fall precautions for the
        duration of the patient stay,
        regardless of assessment of

        FIGURE 2.
        Fem Block Stop Signage

        STOP

        Do Not Get Out of Bed
        Call for Help

        FIGURE 3.
        Fall Prevention Signage

        Fem-Block
        High Risk for Falls!

        Patient:
        Room:
        Date/Time Stopped:

        return of motor function and
        sensory function.

        3. Maintain fall risk signage for the
        duration of the patient stay.

        4. Place signage at the head and
        foot of the bed to reinforce mes-
        saging for the patient, family,
        and staff (see Figures 2 & 3).

        Fall Risk Signage
        Patients typically have the FNB

        removed on postoperative day 2 in

        the early morning. Patients generally
        are discharged on postoperative day
        4 either to home or a rehabilitation
        facility. To im prove patient safety,
        the team decided signage would
        remain for the entire length of stay.

        UAP Education/Tip Sheet
        Based on findings from the litera-

        ture, a one-page educational sheet
        was developed for all UAP (see Figure
        4). The tips were developed by the

        FIGURE 4.
        Safety in Caring for the Patient with a Femoral Nerve Block

        A femoral nerve block is a peripherally inserted catheter that delivers a numbing
        medicine to cover the femoral nerve. A TKR patient usually has the catheter in
        place for 48 hours.

        Structures Seen on Ultrasound in Left Femoral Space
        (viewed from foot)

        The catheter is placed just below the skin surface, next to the femoral nerve. The
        catheter coats the nerve with numbing medicine; this allows for blocking of the
        painful sensations from the hip down the patient’s leg.

        The medicine will numb the patient’s leg. The thigh muscle, or quadriceps, will be
        very weak.

        The leg will be warm, and may be slightly warmer than the non-affected leg.

        The patient will always need two assists when getting out of bed with this catheter
        in place and for a certain period of time after removal.

        Maintain the patient on The Falling Star Program.

        After removal of the femoral nerve block, the same safety precautions will remain
        until the patient has regained complete sensation in the leg. You need to check with
        the nurse before moving the patient to determine if the patient has feeling back in
        his/her leg and identify if the patient can be transferred with one assist.

        Source: Reprinted with permission from Vander Beek, J. (2005).

        Advanced Practice

        July-August 2013 • Vol. 22/No. 4 249

        Atkinson, H.D. (2008). Postoperative fall after
        the use of the 3-in-1 femoral nerve block
        for knee surgery: A report of four cases.
        Journal of Orthopaedic Surgery, 16(3),
        381-384.

        Centers for Medicare and Medicaid Services
        (CMS). (2011). Medicare fact sheet:
        Proposals for improving quality of care
        during inpatient stays in acute care hospi-
        tals in the fiscal year 2011 notice of pro-
        posed rulemaking. Retrieved from http://
        www.cms.gov/Medicare/Medicare-Fee-
        for-Service-Payment/AcuteInpatientPPS/
        downloads/FSQ09_IPLTCH11_NPRM04
        1910.pdf

        Kasibhatia, R.D., & Russon, K. (2009).
        Femoral nerve blocks. Journal of
        Perioperative Practice, 19(2), 65-69.

        Muraskin, S.I., Conrad, B., Zheng, N., Morey,
        T.E., & Enneking, M.D. (2007). Falls
        associated with lower-extremity-nerve
        blocks: A pilot investigation of mecha-
        nisms. Regional Anesthesia and Pain
        Medicine, 32(1), 67-72.

        Rutherford, P., Moen R., & Taylor, J. (2009).
        TCAB: The “how” and the “what.”
        American Journal of Nursing, 109(11), 5-
        17.

        Sharma, S., Iorio, R., Specht, L.M., Davies-
        Lepie, S., & Healy, W.L. (2010). Compli –
        cations of femoral nerve block for total
        knee arthroplasty. Clinical Ortho paedics
        and Related Research, 468(1), 135-140.

        Vander Beek, J. (2005). Finding the femoral
        nerve. Retrieved from http://www.neurax
        iom.com/html/finding_the_femoral.php

        ADDITIONAL READINGS
        Schulz-Stubner, S., Henszel, A., & Hata, J.S.

        (2005). A new rule for femoral nerve
        blocks. Regional Anesthesia and Pain
        Medicine, 30(5), 473-477.

        Turjanica, M.A. (2007). Postoperative continu-
        ous peripheral nerve blockade in the
        lower extremity total joint arthroplasty
        population. MEDSURG Nursing, 16(3),
        151-154.

        FIGURE 5.
        Falls Associated with Femoral Nerve Blocks per Month

        (January 2009 – September 2010)

        TCAB team in collaboration with
        physical therapists. This education
        guide was reviewed with and sup-
        plied to all UAPs, and has been
        incorporated into new hire orienta-
        tion for employees on these units.
        The educational process consisted of
        either 1:1 education or group ses-
        sions. The educator continued to
        contact UAPs individually to vali-
        date understanding of the informa-
        tion provided.

        Nursing Implications
        In the calendar year 2009, Phippen

        6 and 7 had a reported falls rate of 5.2
        per 1,000 patient days. Following
        implementation of the FNB educa-
        tion plan and bundle, the unit fall
        rate decreased to 2.9 per 1,000 patient
        days, with a facility reported rate of
        3.52 per 1,000 patient days (see Figure
        5). The bundle was effective in
        decreasing falls among patients with
        FNB, also contributing to the im –
        proved overall fall rate.

        The team has been able to sustain
        the gains, in large part because of the
        interdisciplinary and multifaceted
        approach to analyzing the issue, pro-
        viding education, and implementing
        necessary practice changes. The sig-
        nage has continued to have a posi-
        tive influence on the fall prevention
        project as it serves as a helpful visual
        reminder for staff, patients, and fam-
        ilies. Education, audits, and re mind –

        ers to keep signs in place are ongo-
        ing. Staff members now utilize the
        two-person assist method with all
        affected patients during the duration
        of the FNB as well as after the block
        is removed, until sensation and
        motor function have returned as
        determined by the nurse. Patients
        are more aware of the need for assis-
        tance now due to the signage and
        education sheet. Patients and fami-
        lies have identified the value of the
        information. All newly hired staff
        members review the bundle during
        the orientation period. Fall data also
        continue to be evaluated.

        Conclusion
        The TCAB approach engaged unit

        leaders, clinicians, and patients to
        improve the quality and safety of
        patient care on two orthopedic-
        neurologic units. There was only one
        recorded fall in patients with FNB
        after implementation of the FNB
        bundle, from September 2009 to
        December 2010. It is amazing what a
        little bit of knowledge and education
        can accomplish!

        REFERENCES
        Agency for Healthcare Research and Quality.

        (2010). The falls management program:
        A quality improvement initiative for nurs-
        ing facilities. Retrieved from http://www.
        ahrq.gov/research/ltc/fallspx/fallspxman
        ual.htm

        Jan
        2009

        Mar
        2009

        May
        2009

        July
        2009

        Sept
        2009

        Nov
        2009

        Jan
        2010

        Mar
        2010

        May
        2010

        July
        2010

        Sept
        2010

        N
        u

        m
        b

        e
        r

        o
        f

        F
        a
        lls

        2.5

        2

        1.5

        1

        0.5

        0

        Date

        Thou Shalt Not Fall! Decreasing Falls in the Postoperative Orthopedic Patient with a Femoral Nerve Block

        Reproduced with permission of the copyright owner. Further reproduction prohibited without
        permission.

         

        Many research psychologists have research teams they work with and some members of the team end up on the publications while others do not. For two months during summer, Ann conducted research as an undergraduate student at a well-known university. She spent long hours in the laboratory injecting mice with opiate blockers to look at pain tolerance. She was responsible for shocking them, as a test for pain tolerance, and euthanizing them at the end of the study. When the article was published months later, Ann was surprised to find her name was only included in a note of thanks. What do you think about this situation?

        • open attachment 

        Topic: Connected vechicles

         Research (Applications, Implementations, Available Guidelines), 

        Conclusions/Recommendations, 

        and References.

        Home>Business & Finance homework help
        marketingMGMT

        Case study source: 

         The Sidney Opera House construction: A case of project management failure (eoi.es) 

         The Sydney Opera House is one of the best-known iconic buildings, recognized around the  world as a global symbol of Australia. The Danish architect Jørn Utzon won the architecture  competition set out by the New South Wales government for the new building in 1957, and the  construction started in 1959. The project was originally scheduled for four years, with a budget  of AUS $7 million. It ended up taking 14 years to be completed and cost AUS $102 million. The  Sydney Opera House could probably be seen as one of the most disastrous construction projects  in history not only from the financial point of view but also for the whole management plan. Lets  analyze the main reasons that led to it.  First of all, at the beginning of any project goals and objectives have to be clearly defined by the  client to provide a guideline for what the project must complete. There are three main factors:  time, cost, and quality. In the case of the Sydney Opera House the last one was the most  important, as it was an almost unrestricted goal of the project and the reason why it was  launched. No indications regarding time or cost limits were either provided for the competition.  Thus, the architects were allowed total freedom in their designs. After Utzon was selected, he presented his “Red Book” in March 1958, which consisted of the  Sydney National Opera House report. It comprised some indications such as plans, sections,  reports by consultants, etc. The funds came almost entirely from a dedicated lottery, so the  project was not a financial burden for the government. Regarding time planning the goal was to  complete the construction at the end of 1962 and have the grand opening at the start of 1963. The  project should have lasted four years. The main stakeholder was the architect, but Utzon was  much more concerned with the design aspect rather than time and costs objectives, which proved  problematic. During the project, Utzon collaborated with Ove Arup, who was in charge of the  structure and the engineering. With some other subcontractors, the team was in charge of  mechanics, electrics, heating and ventilating, lighting and acoustics. There was no real project  manager, but rather collaboration between Utzon and Arup. The other main stakeholder was the client, the state of New South Wales. This encompassed the  Australian government, which launched the competition for the project, and especially the Labor  Premier, Joe Cahill. A part-time executive committee was created to provide project supervision  but the members had no real technical skills. The government eventually became an obstacle to  the project team by inhibiting changes during the progress of the operations and thus contributed  to cost overrun and delays. Finally, the public was an indirect stakeholder because they were  concerned with the projects success. There appeared to be problems from the start of the project that was divided into three stages:  Stage 1 was the podium, stage 2 was the outer shells, and stage 3 was the interiors and windows.  Apparently Utzon protested that he had not completed the designs for the structure, but the  government insisted the construction had to get underway. In addition, the client changed the  requirements of the design after the construction was started, moving from two theatres to four,  so plans and designs had to be modified during construction. Regarding the project’s budget the initial estimation was drawn on incomplete design drawings  and site surveys which later lead to disagreements. The contractors for the first stage successfully  claimed additional costs of AUS $1,2 million in 1962 due to design changes. When it was  completed in 1963, it had cost an estimated AUS $5.2 million and it was already 47 weeks over  schedule for the whole project. Stage two became the most controversial stage of the entire construction. As costs were rising a  new government stepped in and monitored all payments being requested by the Opera House. By  the end of stage one, Utzon submitted an updated estimate of the projects total cost as AUS$12.5  million. As more payments were being delivered and no visible progress was seen, the  government began withholding payments to Utzon. Stage two slowed down and in 1966 Utzon  felt he was forced to resign from the project as his creative freedom was restricted, and therefore  could not bring his perfect idea to fruition. The project was then taken over by three Australian engineers, and stage two was completed in  1967 with a total cost of AUS$13.2 million. When Utzon walked out of the project, he did not  leave any designs or sketches to work with as he was convinced that he would be called back to  the project once the new team failed. This was not so, and due to the lack of designs to work  with, new ones had to be created based on the current structure of the Opera House and many  unforeseen complications were found. Evidently this caused a huge increase in the estimate of  the total cost of the project, which came to AUS$85 million. This came as a shock and nearly an  insult to Utzon who had been fending off the Government from rising costs for years. The news  that they had agreed to that budget, which was more than four times Utzon’s original estimate,  was evidence that he had been unjustly treated. Apparently, there were a lot of delays and cost overruns. The original cost was to be 7 million  dollars and its construction was supposed to be completed by 26 January 1963. But this was only  on paper. The reality was quite different. The Sydney Opera House ended up costing 102 million  dollars and was completed in 1973. Many experts in project management say its construction is  an example of poor or bad project management. But should we always measure the success of a  project by the triple constraints of cost, schedule and quality? Utzon was losing control of the situation and had an undesirable pressure under him. The initial  cost was (Aus) 7 million dollars and in the end it has cost (Aus) 102 million dollars and a total of  14 years to be constructed, 6 more than it should be*. The Arup, engineers contracted for the  engineering part stayed until the end of the project but Utzon left in the end , after designing the  roof but not concluding. During the project, Utzon collaborated with Ove Arup, who was in  charge of the structure and the engineering while subcontractors were in charge of mechanics,  electrics, heating and ventilating, lighting and acoustics. There was no real project manager, but  rather collaboration between Utzon and Arup. When the construction started there was no clear  concept of how the roof might be constructed. It’s not that the estimates were wrong; it’s that  there was nothing to base the estimates on in the first place. Much of the delay and cost overrun  was caused by iteration on roof design and lack of Data, eventually landing on a solution that  constructed the roof out of interlocking tiles, but this solution was only discovered after a lot of  time and effort The other main stakeholder was the client, the state of New South Wales (Australian  government). A executive committee was created to provide project supervision but the members  had no real technical skills. It was hard to keep two of the key stakeholders happy, the minister  David Hughes and the SOHEC – Sydney Opera House Executive Committee so he decided to  quit blaming the first of lack of cooperation but in fact even the acoustic consultants did not  agree between each other and as a result of all these changes of plans and misunderstandings the  Sydney Opera House – finished by three local architects – still did not had the proper acoustic,  which was the first main factor that lead to a new opera house*. Nowadays the Sydney Opera House is already seen as profitable since its cost was already  covered by the revenue made from customers (tourists mainly) but further improvements on  accessing conditions were taken. Stakeholders Before going back to the subject it is needed to  take into account that a failed project is a project that is cancelled before completion, never  implemented, or damaged in some way. Other reasons that why projects fail are an absence of  commitment, a bad project organisation and planning, a bad time management, lack of managerial control, extra costs among other problems. Queen Elizabeth II inaugurated the  Sydney Opera House in 1973, after 17 years of redesigns, underestimates and cost overruns. By  1975, the building had paid for itself, thanks mainly to the lottery system that was created to help  its funding. Utzon was never to return to Australia, never to see the final result of his work that  was recognized as an incredible feat of architecture. In 2003 the architect was honoured with the  Pritzker Prize for architecture, the most renowned architectural prize in the world. 

        To Do- format using proper citation, headings  and structure 

        1- Explain the consequences of underestimating the initial planning in this project and ways to address this problem 

         2- Recommendation on what you would have done differently.

          • 2 months ago
          • 5
          Report Issue

          Evidence Based Practice Project Paper

          Evidence Based Practice Project Paper

          Criteria

          Ratings

          Pts

          This criterion is linked to a Learning OutcomeIntroduction/Conclusion

          30 pts

          Level 5

          Grabs the reader’s attention; provides a complete and concise introduction/conclusion to the paper; a purpose statement relevant to the paper is included.

          27 pts

          Level 4

          Interesting & might get the reader’s attention; provides a complete introduction/conclusion; purpose statement is included, but is vaguely worded.

          24 pts

          Level 3

          Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, or too short; purpose statement is included, but is vaguely worded.

          21 pts

          Level 2

          Relevant but does not engage the reader’s attention; provides an introduction/conclusion, but it is incomplete, lengthy, and/or too short; purpose statement not included

          18 pts

          Level 1

          Dull or trite introduction/conclusion; incomplete or rambling; no purpose statement included.

          0 pts

          Level 0

          No paper was submitted.

          30 pts

          This criterion is linked to a Learning OutcomeProject Summary

          NM465-CO4

          30 pts

          Level 5

          Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is well-developed and provides sufficient detail.

          27 pts

          Level 4

          Includes a summary of the patient problem project chosen and the rationale for choosing it; support is provided for chosen topic from the healthcare literature showing that this is a patient problem; the summary is developed, but lacks depth.

          24 pts

          Level 3

          Includes a summary of the patient problem project chosen; rationale included, but not well-defined; the topic was not supported by literature as a patient problem; the summary is partially developed.

          21 pts

          Level 2

          Includes an incomplete summary of the patient problem project chosen; rationale, if included, was not well-defined or supported by literature.

          18 pts

          Level 1

          The summary did not discuss the patient problem; no rationale included; rambling or incoherent ideas.

          0 pts

          Level 0

          No paper was submitted.

          30 pts

          This criterion is linked to a Learning OutcomeLiterature Review

          NM465-CO4

          30 pts

          Level 5

          3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are synthesized; Summary of what is known/not known about the problem is included.

          27 pts

          Level 4

          3-5 relevant, scholarly, peer-reviewed articles related to patient problem/proposed intervention are included, but findings are not synthesized; Summary of what is known/not known about the problem is included.

          24 pts

          Level 3

          3-5 articles related to patient problem/proposed intervention are included, but they are either not relevant, not scholarly, or not peer-reviewed; Summary of what is known/not known about the problem is included.

          21 pts

          Level 2

          Less than 3 articles included OR articles included are not related to the chosen topic; Summary of what is known/not known about the problem is not included.

          18 pts

          Level 1

          Less than 3 articles included; no summary of what is known/not known about the problem not included; rambling or incoherent ideas.

          0 pts

          Level 0

          No paper was submitted.

          30 pts

          This criterion is linked to a Learning OutcomeProposed Change

          NM465-CO4

          30 pts

          Level 5

          The proposed change is discussed in sufficient detail; analysis of implementation is well-developed; potential affected parties are discussed.

          27 pts

          Level 4

          The proposed change is discussed; analysis of implementation is somewhat developed; potential affected parties are discussed.

          24 pts

          Level 3

          The proposed change is discussed, but lacks details; analysis of implementation is partially developed; potential affected parties are identified.

          21 pts

          Level 2

          The proposed change is not discussed sufficiently; analysis of implementation is poorly developed; potential affected parties are identified.

          18 pts

          Level 1

          The proposed change is not discussed in a coherent manner; analysis of implementation is not included; potential affected parties are not identified.

          0 pts

          Level 0

          No paper was submitted.

          30 pts

          This criterion is linked to a Learning OutcomeGrammar/APA

          PRICE-I

          30 pts

          Level 5

          Mostly free of grammatical and spelling errors. APA format was used correctly. Thoughts flow cohesively throughout the paper.

          27 pts

          Level 4

          Minimal grammatical and spelling errors. APA format was followed with minimal mistakes. Thoughts flow cohesively throughout the paper.

          24 pts

          Level 3

          Moderate amounts of grammatical and spelling errors. APA format was followed but inconsistently; paper does not flow and does not tie the information together.

          21 pts

          Level 2

          Major grammatical and spelling errors. APA was used incorrectly. Paper does not flow and does not tie the information together.

          18 pts

          Level 1

          An unacceptable number of spelling, and grammar. APA format was not followed. Rambling or incoherent ideas throughout the paper.

          0 pts

          Level 0

          No paper was submitted.

          30 pts

          Total Points: 150


          Previous


          Next

          Running head: Biofilm 2

          Running head: Biofilm 2

          Biofilm-Annotated bibliography

          Institution:

          Student’s name:

          Date:

          Introduction

          The peer-review articles used give specific details on the definition of biofilms and factors considered in effective treatment of biofilms. Cells adhere to one another and, in some cases, to a surface, allowing biofilms to grow and spread. Extracellular polymeric substances bind these adherent cells together in this extracellular matrix. Biofilms can be found on both living and nonliving surfaces (Li et al, 2018). In attaining the purpose of the goal, the annotated bibliography provides data that answers the research question.

          Research Question

          What is biofilm and how is it treated?


          Muhammad, M. H., Idris, A. L., Fan, X., Guo, Y., Yu, Y., Jin, X., … & Huang, T. (2020). Beyond risk: bacterial biofilms and their regulating approaches. Frontiers in microbiology, 11, 928.

          This article defines biofilm based on the constituents that form the biofilms. Based on the review, bacterial biofilms are formed when secreted proteins and extracellular DNA bind to form dense, surface-attached communities. The growth of a bacterial biofilm can be divided into five distinct stages. The first stage is the reversible attachment phase, in which bacteria attach to surfaces in an unspecific manner. The second stage is the irreversible attachment phase, in which bacteria use adhesins to interact with a surface, synthesizing and releasing signaling molecules to detect one another’s presence, resulting in the formation of a microcolony. Healthcare, food production, and the oceans’ ecosystems health are all threatened by biofilms found in drinking water supply. Thus, biofilm control and prevention have become the focus of current studies. This paper provides a thorough introduction to biofilm development. A range of methodologies and approaches are used to tamper with bacterial adhesion and biofilm matrixes in an effort to remove harmful microorganisms from host environments. Plant protection, biotransformation, and wastewater treatment are just a few of the many uses for biofilms. Adhesion surfaces, QS, and environmental factors can all be manipulated to encourage beneficial biofilm growth.

          Hartmann, R., Singh, P. K., Pearce, P., Mok, R., Song, B., Díaz-Pascual, F., … & Drescher, K. (2019). Emergence of three-dimensional order and structure in growing biofilms. Nature physics, 15(3), 251-256.

          The review provides a comprehensive definition of biofilms based on the place of existence. According to the review, biological life forms known as biofilms are most common type of life on Earth and are self-replicating in crystals. The properties of conventional liquid crystals and granular particles are determined by the interaction possibilities between the molecules in the system. In growth-active biofilms, it’s not clear if potential-based descriptions can explain the observed morphologies, and which potentials are most relevant. Cell–cell interaction potential can be used to predict Vibrio cholerae biofilm development, emergent architecture, and local liquid–crystalline order at the microscopic scale. Biofilms’ microscopic creation and three-dimensional morphology are also shown to be affected by external fluid flow. It’s possible that in these active bacterial communities, mechanical cell–cell interactions, which can be controlled by modulating the production of different matrix components, may be the source of local cell membrane order and global biofilm architecture.” These findings focus on providing scientific evidence for improved spectrum theories of active matter, which are critical for controlling biofilm growth.

          Thi, M. T. T., Wibowo, D., & Rehm, B. H. (2020). Pseudomonas aeruginosa biofilms. International Journal of Molecular Sciences, 21(22), 8671.

          Biofilms are the subject of this article, which explains the characteristics and origins of a specific biofilm. Pseudomonas aeruginosa, a bacterium that causes both acute and chronic infections in people with compromised immune systems, is known as an opportunistic human pathogen. Its infamous persistence in clinical settings is largely due to its propensity to form antibiotic-resistant biofilms. One of the most important functions of biofilm is to protect bacteria from the stresses of their environment by providing them with an extracellular scaffold of autogenic polymeric substances. Bacteria can colonize and persist on surfaces for longer when biofilm prevents phagocytosis. Biofilms of P. aeruginosa, including their development stages and molecular mechanisms of invasion and persistence conferred by biofilms, are reviewed throughout the research article. There are interspecies biofilms of P. aeruginosa and common streptococcus that inhibit the virulence of P. aeruginosa and may even improve disease conditions that are produced by the lysis of cells within the bacterial biofilm.

          Otto, M. (2018). Staphylococcal biofilms. Microbiology spectrum, 6(4), 6-4.

          There are different types of biofilms with each having distinct characteristics such as place of existence and survival. This peer-reviewed journal article investigates Staph biofilm development and its role in human health. There is also a summary of current strategies for the development of anti-biofilm therapies. Staphylococci, particularly Staphylococcus aureus and Staphylococcus epidermidis, are the most common cause of indwelling medical device infections. During device-associated infection, the bacteria’s biofilm phenotype facilitates increased resistance to antibiotics and host immune defenses. Biofilms have grown in popularity in recent years as a medium for the growth of microorganisms. It has also been discovered that biofilm-associated primary infections progress or originate in a wide range of human infections, and this is not an isolated phenomenon. In terms of biofilm research, Staphylococci are second only to Pseudomonas aeruginosa. Because Staphylococci are common human skin colonizers, they are the most common cause of biofilm infections on surgically implanted indwelling medical devices. PJIs and other potentially fatal conditions, such as endocarditis and sepsis, are among the most severe of these infections.

          Zhu, Y., Li, C., Cui, H., & Lin, L. (2020). Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science & Technology, 99, 142-151.

          This review explores into the use of cold plasma for anti-biofilm treatment of products that are manufactured as food within the industry. Biofilms may be able to control cold plasma technology through a variety of mechanisms. Cold plasma’s efficacy against biofilms is also examined in detail in the final chapter, as is the method’s final evaluation as a novel anti-biofilm’s method. Most significant threat to food standards today is biofilm infection, which is a fact that cannot be denied. Due to the biofilm architecture, biofilm microorganisms are more resilient to antibacterial treatment than planktonic microorganisms. By using cold plasma, a new non-thermal processing method, biofilms on food and food-contact materials can be effectively removed from their surfaces. The effectiveness of cold plasma diagnosis in removing biofilms has sparked a new wave of interest in this topic in recent years.

          Li, C., Cornel, E. J., & Du, J. (2021). Advances and Prospects of Polymeric Particles for the Treatment of Bacterial Biofilms. ACS Applied Polymer Materials, 3(5), 2218-2232.

          This review focuses on polymeric nanoparticles for the treatment of bacterial biofilms, with the goal of summarizing their preparation, mechanism, and recent advances. The researchers begin by investigating the physiological aspects of the bacterial biofilm. A list of physiological factors in biofilms, such as pH, enzymes, reactive oxygen species, hypoxia, and others, can be found here. Following this section, the antibiofilm therapeutic properties of polymer micelles, polymersomes, dendrimers, nanogels, and other polymeric nanoparticles will be discussed in great detail. Polymeric nanoparticles’ toxicity is also examined. Antibiofilm step approach on polymeric nanoparticles face both current and future challenges. Bacterial biofilms are receiving more attention than ever before from antibacterial researchers. A significant challenge remains in treating bacterial biofilms despite advances of antimicrobial agents, including antibiotics. This is due to the fact that bacterial biofilms avert the diffusion and accumulation of antimicrobials. It is possible to enter bacteria biofilms and alter the chemical properties of their microenvironment, allowing polymeric nanoparticles to engage with bacteria or discharge drugs that have been preloaded, due to their specific size and structure.” Polymeric nanoparticles with antibiofilm properties are being developed, and this bodes well for future antibiofilm therapeutics.

          Barzegari, A., Kheyrolahzadeh, K., Khatibi, S. M. H., Sharifi, S., Memar, M. Y., & Vahed, S. Z. (2020). The battle of probiotics and their derivatives against biofilms. Infection and Drug Resistance, 13, 659.

          Chronic infections, device-related diseases, and medical device malfunction are all examples of biofilm-related infections that have become a significant clinical issue. They are a global health threat because they are inaccessible by the immune system and antibiotics. Getting rid of biofilms by interfering with their adhesion as well as maturation has been found to be an effective strategy. Using probiotics and their derivatives to combat pathogenic biofilms has become increasingly popular in recent years. Probiotics are the subject of this review because they can help prevent bacterial biofilms from forming and maturing. Approximately 65% to 80% of microbial and chronic infections are caused by biofilms, according to the National Institutes of Health (NIH). Microbial biofilms that form on implanted devices (such as aortic valve, catheters, and joint replacements) increase the risk of infection for patients in the hospital. The use of probiotics and their derivative products in the treatment of biofilm infections could benefit from further research.

          Wu, Y. K., Cheng, N. C., & Cheng, C. M. (2019). Biofilms in chronic wounds: pathogenesis and diagnosis. Trends in biotechnology, 37(5), 505-517.

          Treatment of biofilms requires a comprehensive understanding of the functionality of biofilms in a given set up. According to the review, biofilms have been shown to have a crucial function in the progression of chronic wound infections. It is a long time before chronic wound biofilms can be accurately diagnosed, despite advances in understanding of the underlying mechanism. As well as providing an overview of current diagnostic approaches based on morphological features, microbiology, and molecular assays for chronic wound biofilms, this review will discuss the mechanism by which biofilm formation takes place. There is still an unmet clinical need for wound blotting and transcriptomic analysis, for example. Wound healing has been slowed because of biofilms, which have recently gotten more attention. Multi-pronged strategies are employed in biofilm-based wound care in order to remove biofilms first from wound bed and to maintain epithelial integrity in the wound. Biofilms on wound surfaces cannot be accurately identified by current pre – clinical and clinical diagnostic techniques, making timely medical and surgical intervention impossible. Point-of-care biofilm discovery in chronic wound care will benefit greatly from the on-going development of these advanced laboratory approaches.

          Magana, M., Sereti, C., Ioannidis, A., Mitchell, C. A., Ball, A. R., Magiorkinis, E., … & Tegos, G. P. (2018). Options and limitations in clinical investigation of bacterial biofilms. Clinical Microbiology Reviews, 31(3), e00084-16.

          This review article summarizes the methodological landscape of biofilm analysis, with an assessment of current trends in methodological research reflected in the findings. Such findings form a basis for treatment of biofilms. Only 5percent of the total of the biofilm literature is focused to methodology, according to a keyword-focused bibliographic search conducted by the researchers. Depending on the composition of the microbial community and the microenvironment, bacteria can form single-species or multispecies biofilms. Within an extracellular matrix that they have constructed, bacteria or viruses exist side by side in complex and multifaceted communities known as biofilms (ECM). Due to the beauty and sophistication of these multicellular communities, along with their role in infectious diseases, biofilm development has received much attention in the last two decades. On nearly any surface, biofilms can form, and they can be either beneficial or harmful, depending on the community’s interactions with the surface and other living things. Comprehensive searches of literature yielded a new understanding of biofilm structure and function and the role they play in disease and host-pathogen interaction.

          Chen, Z., Wang, Z., Ren, J., & Qu, X. (2018). Enzyme mimicry for combating bacteria and biofilms. Accounts of Chemical Research, 51(3), 789-799.

          Biofilms can be treated through a variety of ways as investigated and supported through research. As a global health issue, bacterial infection is on the rise and antibiotics are the most widely accepted treatment paradigms. Increased antibiotic resistance has resulted from overuse and misuse of antibiotics, making treatment less effective and resulting in higher mortality rates. Bacterial biofilm formation on living and nonliving surfaces makes it even more difficult to combat bacteria because the extracellular matrix can act as a strong barrier to prevent antibiotic penetration and resist environmental stress. This makes it even more difficult to combat bacteria. Because bacteria and biofilms can’t be completely eliminated, they can lead to implant failure, device damage, and persistent infection. To avoid the development of bacterial resistance, it is critical to develop new antimicrobial agents. The creation of artificial enzymes that mimic the functions of natural enzymes will open up new avenues for combating bacteria. In addition, artificial enzymes are more stable, more easily tunable, and can be produced in large quantities for practical use than natural enzymes. Therefore, this can be a viable way to treat biofilms.

          References

          Barzegari, A., Kheyrolahzadeh, K., Khatibi, S. M. H., Sharifi, S., Memar, M. Y., & Vahed, S. Z. (2020). The battle of probiotics and their derivatives against biofilms. Infection and Drug Resistance, 13, 659.

          Hartmann, R., Singh, P. K., Pearce, P., Mok, R., Song, B., Díaz-Pascual, F., … & Drescher, K. (2019). Emergence of three-dimensional order and structure in growing biofilms. Nature physics, 15(3), 251-256.

          Li, C., Cornel, E. J., & Du, J. (2021). Advances and Prospects of Polymeric Particles for the Treatment of Bacterial Biofilms. ACS Applied Polymer Materials, 3(5), 2218-2232.

          Magana, M., Sereti, C., Ioannidis, A., Mitchell, C. A., Ball, A. R., Magiorkinis, E., … & Tegos, G. P. (2018). Options and limitations in clinical investigation of bacterial biofilms. Clinical Microbiology Reviews, 31(3), e00084-16.

          Muhammad, M. H., Idris, A. L., Fan, X., Guo, Y., Yu, Y., Jin, X., … & Huang, T. (2020). Beyond risk: bacterial biofilms and their regulating approaches. Frontiers in microbiology, 11, 928.

          Otto, M. (2018). Staphylococcal biofilms. Microbiology spectrum, 6(4), 6-4.

          Thi, M. T. T., Wibowo, D., & Rehm, B. H. (2020). Pseudomonas aeruginosa biofilms. International Journal of Molecular Sciences, 21(22), 8671.

          Wu, Y. K., Cheng, N. C., & Cheng, C. M. (2019). Biofilms in chronic wounds: pathogenesis and diagnosis. Trends in biotechnology, 37(5), 505-517.

          Zhu, Y., Li, C., Cui, H., & Lin, L. (2020). Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science & Technology, 99, 142-151.

          Research a research-based article within your local Library or the AHIMA BoK for AHIMA members.  Provide a brief summary of the article findings (250 -300 words) and explain whether the research study relates to basic research or applied research methods.  Page 8 of the Watzlaf and Forrestal book provides a good differentiation between the two types.   If you think your study actually is a combination of both research methods please describe.   There is no right or wrong answer but your 2 -3 sentence explanation must justify what type of research method you have identified.   Provide the reference for your article in APA format, after your summary. 

          The research should be something in epidemiology, we are basically looking for research based article that either uses basic research or applied research. Whatever research based article you choose should relate to either of the two. If the research article you choose is a combination of both, then you also describe.

          It is worth 100 points.

          ENC 1102, 1/31/22

          Prof. Scarpati

          First Research Paper, due Wednesday, March 16, 2022

          St. Thomas University, Miami Gardens, FL

          Research Paper

          Your first research paper, 7 – 10 pages in length with a bibliography and citations (follow the MLA for pagination purposes), will be due Wednesday, March 16, 2022, which is approximately half-way through the semester, given that a semester is 17 weeks in length. Your analysis of the literature studied in class must reach at least seven pages, as the bibliography—titled References—should not be considered when page length is provided. Follow the examples in the MLA style sheet that are presented in the text or access the Modern Language Association’s style sheet on the net or in the stacks in the library, to paginate your secondary sources that bolster and support your thesis statement.

          Process

          This is just a suggestion as writing is an individual thing, but we will cover the process of analyzing literature in class several times by first writing an outline, in order to find major topics for development, to include material to be covered in different paragraphs, and to arrive at a thesis statement. The best way to approach this outline is first to determine the literature that you would like to consider for development. Don’t spend too much time with regard to this assessment; just go with your feelings following a first or second read of the short story of your choice. You may want to include more than one story for development of your thesis statement, but you certainly don’t have to do this. The way that I approach the outline is to randomly write my assessments of what I believe to be major areas for development by the author. You can include specific parts of the story for inclusion in these major areas, or you may want to include these areas in a separate process where notes on the primary story take place. Either way the idea is to present a major idea for development in a topic sentence with specific details concerning information presented by the author in the story included to round out the examples you present in your paragraphs. That is the essence of good writing, broad general ideas presented in your topic sentences with four to six sentences provided as examples supporting these topic sentences in the rest of the paragraph. Focus on the thesis statement should be your number one concern. Consider utilizing transitions leading your reader from one sentence to the following one and from one paragraph to the next.

          References

          It is not imperative to research many secondary sources to bolster your thesis. But it is wise to take notes based on your secondary research of outside sources and how these writers analyze the story under consideration and how these assessments apply to your thesis statement. Instead of quoting directly from these sources, it is suggested you provide your assessments of these writers’ analysis, by incorporating a synthesis of assessing why their words make sense to support your thesis. Using wording such as “According to” when introducing outside secondary sources and then naming the author’s last name and then proceeding with your take on why the information makes sense in the course of your development of the thesis is highly suggested. When you use direct quotes, the effect is jarring because the professional writer will certainly have a greater grasp of the language than you do. Also, using many direct quotes leads me to believe that you are desperate to reach the minimum length. Just believe in your own assessments and analysis of the literature, and you will most likely be in better shape than to place too much emphasis on published assessments of the literature.

          Proofing

          Give yourself a couple of days before finalizing the editing of your work. The best scenario is to finish the paper and then return to it in a day or two, to begin the proofreading process. Pay attention to grammar and the notion of providing variety with respect to sentence structure throughout your essay. Subject-verb agreement should also be strongly considered, as should run-on constructions (avoid) and fragments (also avoid).

          1



          Evidence-Based Practice Project Paper


          Objective:

          1. Explain the role of nursing research within clinical practice.


          Topic:

          Overview

          In this assignment, you will describe a patient problem that you see or have seen in practice. You will then identify, revise, or develop a policy, protocol, algorithm, or standardized guideline to be used in your practice site that is based on current research evidence. You are proposing the implementation of an intervention that is supported by research; thus you are proposing an evidence-based practice (EBP) project. You are not proposing a

          study to be conducted in your agency.

          Your final paper should be no more than 5 pages, which does not include the protocol, policy, or algorithm, and references for your project. This assignment is worth 100 points.

          Ideas for Selection of an Evidence-Based Intervention for Practice

          Describe a patient problem that is relevant to your practice. It can be any patient care problem or issue that is of interest to you in your current practice or for your future role as an administrator. Find an intervention that is considered effective based on research to manage this problem. Important clinical areas that have been researched include the following:

          · Fall prevention or management

          · Prevention of pressure ulcers

          · IV and/or arterial line management

          · Infection control problems—select a specific situation

          · Pain identification, documentation, and/or management

          · Visitation in ICUs

          · Family involvement intervention based on research

          · Nurse Retention intervention

          · Alternative staffing process

          · Safety—pick a specific situation and implement a research-based intervention to manage it.

          · Shift of care from hospital to home and/or ambulatory care centers

          · Nursing leadership—effective leadership behavior that is research based

          · Communication of shift report in specialized way based on research

          · Provision of specific aspect of care (research-based intervention) to patients with illness such as hypertension, diabetes, congestive heart failure, chronic obstructive lung disease, asthma, obesity, renal problems, gastrointestinal problems, or mental health problems.

          Include the following in your paper:

          · Introduction—provide a brief introduction of your paper including a purpose statement at the end of the introduction (one paragraph)

          · Summarize your project topic—include a summary of the patient problem project you chose and the rationale for choosing it; provide support for choosing your topic from the healthcare literature showing that this is a patient problem (2-3 paragraphs)

          · Literature review—include relevant scholarly, peer-reviewed articles that discuss your patient problem and the proposed intervention. Summarize what is known and not know about the problem selected. At least 3-5 articles should be included in your literature review. (3-5 paragraphs)

          · Proposed Change—Discuss your revision/identification/development of a policy/protocol/algorithm/standardized guideline to be used in your practice site; analyze how it will be implemented and potential affected parties. (provide a copy as an appendix to your paper with any relevant references included) If you are revising a current policy/protocol, please include the original, as well. (3-5 paragraphs)

          · Conclusion—Summarize your paper including your patient problem and proposed change; do not introduce new information here, simply synthesis the information you provided in your paper.

          The Journal of Dental Hygiene 33 Vol. 94 • No. 6 • December 2020

          Abstract
          Purpose: The purpose of this study was to investigate the effects of a professional oral health care program on the oral health
          status and salivary flow of elderly people living in nursing homes.

          Methods: Elderly residents aged ≥ 65 years, living in a nursing home, were randomly assigned to either a one-week interval, two-
          week interval, or control group, and received an oral health intervention accordingly over a period of 12 weeks. Plaque index,
          tongue coating, gingival index, and salivary flow rate were compared before and after the oral health intervention within and
          between the groups.

          Results: The plaque, tongue coating, and gingival indices of the participants who received the oral health intervention
          decreased significantly; while the salivary flow rate significantly increased. Plaque, tongue coating, and gingival indices
          decreased most significantly in the one-week interval group, followed by the two-week interval group, relative to the control.
          The salivary flow rate increased most significantly in the one-week interval group, followed by the two-week interval group.

          Conclusion: A professional oral health care program is effective for improving the oral health and salivation of elderly
          residents in nursing homes and the effect was found to be greater with interventions provided at one-week intervals. Oral
          health care professionals, including dentists and dental hygienists, must regularly monitor and manage the oral health of
          elderly residents.

          Keywords: oral health promotion, oral health intervention, elderly, nursing home residents, oral health care, dental
          hygienists, caregivers

          This manuscript supports the NDHRA priority area: Client level: Oral health care (Health promotion: treatments,
          behaviors, products).

          Submitted for publication: 3/11/20; accepted: 6/18/20.

          Effects of Professional Oral Health Care Programs for Elderly
          Residents of Nursing Facilities
          Kyeong Hee Lee, RDH, PhD; Keun Yoo Lee, RDH, PhD; Yoon Young Choi, DDS, PhD;
          Eun Seo Jung, RDH, PhD

          Research

          Introduction
          It can be challenging for most elderly nursing home

          residents to implement oral health care independently due to
          chronic disease, disabilities, or decreased cognitive function
          and assistance in performing activities of daily living are often
          required.1 Poor oral health can lead to oral diseases, which can
          decrease quality of life (QOL) and increase mortality risk.2
          Moreover, the elderly, particularly those in nursing facilities,
          often have chronic illnesses requiring medications with adverse
          oral side effects, such as xerostomia.3 While regular oral health
          care is critical to maintain the QOL of the elderly in nursing
          homes, it often receives a low intervention priority.4

          The lack of onsite dental clinics at Korean nursing homes
          is a barrier to dental care for elderly residents living in such

          facilities.5 Residents with oral health problems must visit the
          local clinic with the help of the nursing home staff, which can
          pose challenges. To address this access to care issue, the Korean
          government reformed the regulations to include dentists
          in the definition of “part-time visiting doctors” providing
          medical services in geriatric care facilities. However, general
          doctors and dentists are commissioned by the individual
          geriatric care facilities. Many of these facilities have chosen to
          extend their contract with the general medical practitioners
          who have been visiting the facility, rather than employ part-
          time visiting dentists. Hence, the oral health care of elderly
          residents is mostly managed by the institutional caregivers.

          The Journal of Dental Hygiene 34 Vol. 94 • No. 6 • December 2020

          Caregivers often regard oral care provision for the residents
          as a minimal part of their overall work.6 Even when the
          caregiver is committed to the care of these individuals, proper
          oral health care provision is hindered by the caregiver’s lack of
          professional education and training in geriatric oral health care.7
          A recent qualitative study of caregivers revealed that methods
          and level of oral care provision for elderly residents varied across
          facilities, depending on the level of commitment of the facility
          head.8 Choi emphasized the need for an oral health intervention
          program run by oral health professionals within the facility in
          order to provide quality dental service.9

          Most previous research on geriatric oral health care
          in nursing homes has targeted caregivers nursing the
          elderly.10-12 Some studies have utilized professional oral health
          care providers, but varied in terms of the method of care,
          intervention duration, and measurement index used.13,14 Lee
          et al.15 developed a one-week interval professional oral health
          care program based on the previous studies.13,14 Their findings
          demonstrated that elderly residents’ oral health status
          improved based on the intervention duration (4 weeks and
          12 weeks). However, the study failed to consider the effect
          of the intervention interval, as only a one-week interval was
          used, which is challenging at the practical level within in the
          context of almost non-existent professional oral health care.16

          The purpose of this study was to investigate the effects
          of implementing a professional oral health care program at
          different intervals, one week or two weeks, on the oral health
          status and salivary flow rate (SFR) of the elderly living in
          nursing care facilities.

          Methods
          Sample population

          The target population was elderly persons aged ≥ 65 years
          residing in nursing homes in the Gyeonggi and Chungcheong
          Provinces in the Republic of Korea. Nursing homes were
          selected through convenience sampling, and informed
          consent was obtained. Each participant was assigned to
          either a one-week interval group, two-week interval group,
          or control group; participants were either bed-ridden patients
          with complete dependence in activities of daily living (ADL)
          or demonstrated partial dependence in ADL. Inclusion
          criteria were individuals who had not received any dental
          care within the past 6 months. Individuals who refused to
          open their mouth due to severe cognitive impairment, those
          with Sjögren’s syndrome, or those who were on salivation
          stimulation medication were excluded from the study.

          A power analysis was performed to determine the minimum
          sample size required for the t-test and was calculated using

          G*Power 3.1 for Windows. For a significance level of 0.05, effect
          size of 0.5, and power of 0.85, at least 38 subjects per group
          were required, however, considering drop-out, 135 participants
          (45 per group) was set as the sample size. Shinhan University
          Institutional Review Board approved the study. Additionally,
          informed consent from all participants was obtained following
          the explanation of the study objective and method of
          participation. In cases of elderly patients with communication
          difficulties, consent from guardians was received.

          To test for homogeneity of the group participants, data on
          general characteristics, long-term care insurance (LTCI) level,
          length of stay (LOS), cognitive function, ADL performance,
          and general health- and oral health-related characteristics
          were collected via a questionnaire. Initial information
          regarding gender, age, education level, and participant-
          partner living arrangement was received prior to starting
          the questionnaire. The Korean version of Mini-Mental State
          Examination (MMSE-K)17 was used to measure cognitive
          function. ADL performance was assessed using the modified
          Barthel index, which had been revised to reflect Korean
          culture and standardized by Jeong et al.18 Data were collected
          on the following categories: number of chronic illnesses,
          number of current medications, recent bouts of pneumonia,
          daily oral care, refusal of oral care, and xerostomia. General
          characteristics and cognitive function were asked directly to
          residents and answers were recorded accordingly. Activities of
          daily living performance and general health- and oral health-
          related characteristics were assessed by the nursing staff, social
          worker, or caregiver.

          Intervention

          The professional oral health care program was implemented
          for 12 weeks; at one-week intervals in the one-week interval
          group, and at two-week intervals in the two-week interval group.
          In the control group, no professional oral health care program
          was implemented. The intervention was designed based on the
          research method used previously by Lee et al.,15 and was further
          modified and supplemented through expert consultation with a
          dentist, two dental hygiene professors, and two clinical dental
          hygienists. Professional oral care was performed by four dental
          hygienists and lasted about six minutes per participant. To avoid
          any experimenter bias, the study participants were randomly
          assigned to the same dental hygienist each time. Dental
          hygienists were blinded to group selection.

          The professional oral health care intervention was carried
          out according to the following procedures. The lip area was
          first cleaned with gauze soaked in a disinfectant mixture
          of saline and mouth rinse (Listerine, McNeil Consumer
          Healthcare; Fort Washington, PA, USA). Vaseline Petroleum

          The Journal of Dental Hygiene 35 Vol. 94 • No. 6 • December 2020

          jelly was then applied to the lips. For participants with
          dentures, each denture was removed and cleaned of debris
          via a suction device. The teeth and tongue were cleaned using
          a combination of rolling brushing, Watanabe brushing,
          and Bass brushing methods. Interdental brushes were used
          to clean the interproximal areas in the posterior region.
          The participant was then asked to rinse with water. If the
          participant had difficulty with rinsing, a suction device was
          used to remove the water. After removing debris in the oral
          cavity, the tongue was wiped using a sponge brush soaked in
          chlorhexidine and squeezed to remove excess. A moisturizer
          was then applied. The buccal mucosa was massaged using
          either the handle of a toothbrush or a finger, the upper/lower
          lips were stretched outwards for five seconds for each of three
          cycles, and the buccal and lingual gingivae were massaged
          using the thumb and index finger. Areas of the parotid,
          submandibular, and sublingual glands were massaged ten
          times each. Each participant was provided with an interdental
          brush and a sponge brush, which were replaced once every
          two months and at each visit, respectively. Patients wearing
          dentures were provided with denture cleansers.

          Outcome measures

          The oral health status pre- and post-intervention was
          examined to evaluate the effects of the professional oral
          healthcare program. The O’Leary index,19 Winkel Tongue
          Coating Index,20 Löe & Silness gingival index,21 and salivary
          flow rate (SFR),22 were measured. Additionally, an oral
          examination was performed by a single dentist and post-
          intervention oral health status was assessed in all groups,
          three days after program termination.

          The O’Leary index19 is a quantitative measurement of
          individual oral status. Disclosing agent was applied to all
          teeth. Each tooth was first divided into four surfaces (mesial,
          distal, buccal, lingual) and the coloring on each surface
          was recorded as a score of 0 for “No plaque” or 1 for “With
          plaque,” indicating poorer hygiene control. The occlusal and
          incisal surfaces and any missing teeth were excluded from
          measurement.

          Tongue coating was evaluated using the Winkel Tongue
          Coating Index (WTCI).20 With the patient’s mouth wide
          open, the tongue was divided into six sections, two vertical
          sections from tip to base and three horizontal sections. Tongue
          coating for each section was rated as 0 for “No coating,” 1 for
          “Light coating,” or 2 for “Heavy coating.” The sum of these
          scores (range: 0-12) indicated the total amount of coating.

          The Löe & Silness gingival index21 is widely used for
          measuring the level of periodontal disease by examining four
          sections (mesial, distal, buccal, lingual) of the gingival margin.

          For each section, the level of inflammation was evaluated as 0
          for “No inflammation,” 1 for “Mild inflammation with slight
          changes in color and edema, but no bleeding on probing,”
          2 for “Moderate inflammation with redness, edema, and
          bleeding on probing,” and 3 for “Severe inflammation with
          redness, hyperplasia, and spontaneous bleeding.” The total
          sum of the scores was then divided by the total number of
          gingival margins examined, with 0 indicating healthy gingiva.

          Salivary flow rate was measured using the swab method.22
          Without having brushed their teeth for two hours following
          breakfast, participants were asked to swallow to void the
          mouth of saliva prior to measurement. Dental cotton rolls
          were placed in the mouth (1.3 × 3.2 cm, Richmond Dental
          Company; Charlotte, NC, USA): one under the ventral
          surface (sublingual salivary gland) and one each in the left
          and right maxillary buccal regions (submandibular salivary
          glands). After five minutes without any movement, the cotton
          rolls were removed and their weight was measured using a
          CB Series (CB-200) digital scale with a resolution of 0.01 g
          (A&D Co., Ltd., Jinchoen, Korea).

          Data analysis

          Data was analyzed using SPSS Statistics software
          (version 22.0, IBM Corporation, Armonk, NY, USA) and
          the significance level was set to 0.05. A chi-square test was
          conducted for categorical variables, For continuous variables,
          one-way analysis of variance (ANOVA) with Scheffe’s post-
          hoc test was performed. Analysis of covariance (ANCOVA)
          was conducted to compare post-intervention-measured
          values between groups. However, SFR was not identified
          as a significant interaction term for ANCOVA. Therefore,
          the homogeneity of pre-intervention measurement values
          was first verified. Then, inter-group comparison of post-
          intervention measurements was then performed using one-
          way ANOVA. To identify pre-to-post changes, a paired t-test
          was performed.

          Results
          Evaluation of the general characteristics, LTCI level, LOS,

          cognitive function, and ADL performance revealed that all
          variables except for cognitive function were not significantly
          different among the groups (Table I). No general health-
          or oral health-related characteristics differed significantly
          among the groups, confirming their homogeneity (Table II).
          The one-week interval group and the control group mostly
          had two illnesses; all three groups typically used one to three
          medications. Most had no recent history of pneumonia;
          performed daily oral care, did not refuse oral care, or reported
          having xerostomia.

          The Journal of Dental Hygiene 36 Vol. 94 • No. 6 • December 2020

          The results of the paired t-tests comparing the effects of the professional oral care
          program are displayed in Table III. After intervention, the O’Leary index decreased by 0.90
          and by 0.47 in the one week and two-week interval groups, respectively (p < 0.001). There
          was no statistically significant change in the control group. The Winkel Tongue Coating
          Index decreased by 3.81 post-intervention in the one-week interval group (p < 0.001), but
          there was no significant change in the two-week interval or control groups.

          The Löe & Silness gingival index decreased post-intervention by 2.18 and 1.09 in the
          one-week and two-week interval groups, respectively (p < 0.05), with no significant change
          in the control group. The SFR increased post-intervention by 0.42 and 0.26 in the one-
          week and two-week interval groups, respectively (p < 0.05), and decreased by 0.08 in the
          control group (p < 0.05).

          The plaque index, gingival index, and tongue coating index decreased most significantly
          in the one-week interval group, followed by the two-week interval and lastly the control
          groups; while SFR increased most significantly in the one-week interval group, followed by
          the two-week interval group (p < 0.001).

          Discussion
          This study aimed to assess the effects of an oral health care intervention program on the

          oral health status and salivary flow of elderly residents living in a long-term care facility.
          Prior to the intervention, homogeneity across the one-week and two-week interval groups,
          as well as the control group, was confirmed; only cognitive function differed between the

          groups. Elderly residents in long-
          term care facilities frequently
          have difficulty performing oral
          care independently as a result of
          impaired cognition, mobility,
          or hand joint micromotion and
          are generally at high risk for oral
          diseases.23 Patients with impaired
          cognitive function tend to forget
          about personal oral health care,
          display resistant behavior to oral
          care performed by nursing staff,
          and have difficulty expressing oral
          pain or discomfort, if present.24
          Although participants’ cognitive
          function differed significantly
          across groups, the MMSE-K score
          was < 19 (dementia) in all groups,
          indicating general impairment.
          Moreover, the ADL score was
          25–49 in all groups, indicating
          maximum dependence.18 Since
          most of the participants required
          assistance, this study concluded
          that there was no problem with
          the homogeneity between groups.

          Pre and post evaluation
          revealed that plaque levels signi-
          ficantly decreased post-inter-
          vention in both of the intervention
          groups, consistent with previous
          findings.15 According to recent
          studies, oral health care is critical to
          preventing aspiration pneumonia
          in the elderly and oral function
          maintenance, muscle strength
          recovery, and mental health.16,25
          The present study demonstrated
          the effect of using a combination of
          various brushing methods to clean
          the tooth surface and an interdental
          brush to wipe the interdental and
          posterior surfaces.

          Elderly residents of nursing care
          homes can suffer hyposalivation
          due to adverse effects of multiple
          medications and the resultant
          increase in tongue coating can

          Table I. Participant demographics* (n=125)

          Characteristic
          1-week
          (n = 38)

          2-week
          (n = 43)

          Control
          (n = 44)

          p-value**

          Sex
          Male 10 (26.3) 8 (18.6) 4 (9.1)

          0.121
          Female 28 (73.7) 35 (81.4) 40 (90.9)

          Age (years) 82.63 ± 9.26 83.14 ± 8.13 85.02 ± 5.76 0.335

          Education

          None 15 (39.5) 19 (44.2) 23 (52.3)

          0.268Elementary school 14 (36.8) 14 (32.6) 7 (15.9)

          ≥ Middle school 9 (23.7) 10 (23.2) 14 (31.8)

          Living with
          partner

          Alive 6 (15.8) 11 (25.6) 8 (18.2)
          0.509

          Widowed 32 (84.2) 32 (74.4) 36 (81.8)

          LTCI
          level***

          Level 1 6 (15.8) 12 (27.9) 3 (6.8)

          0.069Level 2 17 (44.7) 12 (27.9) 22 (50.0)

          Level 3 15 (39.5) 19 (44.2) 19 (43.2)

          LOS (months)*** 15.92 ± 13.37 15.49 ± 12.12 18.48 ± 9.08 0.434

          MMSE-K*** 17.18 ± 6.98 a 15.07 ± 6.12 ab 13.16 ± 7.84 b 0.039

          ADL*** 33.45 ± 28.67 46.56 ± 33.07 34.14 ± 27.18 0.079

          *Data are presented as mean ± SD or n (%)

          **p-values of age, LOS, K-MMSE, and ADL performance were calculated using ANOVA, chi-square tests
          were used for the remainder.

          ***LTCI, long-term care insurance; LOS, length of stay; MMSE-K, Korean version of Mini-Mental State
          Examination; ADL, activities of daily living.

          The Journal of Dental Hygiene 37 Vol. 94 • No. 6 • December 2020

          lead to increased risk of malodor, caries,
          periodontal disease, and fungal infections (e.g.,
          oral candidiasis).26 A sponge brush containing
          chlor-hexidine was used to wipe the oral
          mucosa and tongue followed by the application
          of moisturizer. Tongue coating significantly de-
          creased in the one-week interval group, which
          was consistent with a previous study.15 Tongue
          coating decreased slightly in the two-week
          interval group, but not significantly. Reduction
          effects on tongue coating can vary depending
          on the intervention interval.

          The gingival index score also significantly
          decreased post-intervention in both inter-
          vention groups. According to Matthews et
          al.,27 66–74% of elderly residents in nursing
          homes have comorbid gingivitis and 32–49%
          require treatment for periodontal disease, a
          known risk factor of cardiovascular disease.28
          Efforts to prevent progression from gingivitis
          to periodontitis is necessary. The reduction
          of gingivitis and improvement of periodontal
          condition through oral hygiene care were
          confirmed in this study.

          Salivary gland hypofunction disrupts the
          normal homeostasis of the oral cavity, con-
          tributing to a range of oral diseases including
          dental caries, taste disturbances, candidiasis,
          and difficulties with swallowing, chewing, and
          speaking.29 Ohara et al. reported that oral health
          care, facial and tongue muscle exercises, and
          salivary gland massage can increase salivation
          in elderly patients with xerostomia.30 This study
          demonstrated that SFR significantly increased
          in both experimental groups after massaging
          the salivary glands and oral muscles, with a
          greater effect observed in the one-week interval
          group. This finding has important implications
          for stimulating salivary function.

          Across all measurement indices, the effects
          were two-fold greater in the one-week versus
          two-week interval group, which confirms that
          a shorter intervention interval more markedly
          improves the oral health status and SFR in
          the elderly, which has implications for the
          implementation of a professional oral health
          care program. However, this study only lasted
          12 weeks, and as such, does not reflect the

          Table II. General and oral health-related characteristics

          Characteristic Response
          1-week
          (n = 38)
          n (%)

          2-week
          (n = 43)

          n(%)

          Control
          (n = 44)

          n(%)
          p-value*

          Number
          of chronic
          illnesses

          ≤ 1 12 (31.6) 17 (39.5) 11 (25.0)

          0.5872 15 (39.5) 15 (34.9) 22 (50.0)

          ≥ 3 11 (28.9) 11 (25.6) 11 (25.0)

          Number
          of current
          medications

          ≤ 3 21 (55.3) 24 (55.8) 23 (52.3)

          0.8274-5 14 (36.8) 18 (41.9) 18 (40.9)

          ≥ 6 3 (7.9) 1 (2.3) 3 (6.8)

          Recent
          pneumonia

          Yes 3 (7.9) 2 (4.7) 0 (0.0)
          0.184

          No 35 (92.1) 41 (95.3) 44 (100.0)

          Capable of
          daily oral care

          Yes 25 (65.8) 20 (46.5) 26 (59.1)

          0.122Somewhat 7 (18.4) 19 (44.2) 11 (25.0)

          No 6 (15.8) 4 (9.3) 7 (15.9)

          Refusal of
          oral care

          Yes 8 (21.1) 19 (44.2) 13 (29.5)
          0.076

          No 30 (78.9) 24 (55.8) 31 (70.5)

          Xerostomia
          Yes 32 (84.2) 29 (67.4) 36 (81.8)

          0.138
          No 6 (15.8) 14 (32.6) 8 (18.2)

          *p-values were calculated using chi-square test.

          Table III. Comparison of plaque index, tongue coating index, gingival
          index, salivary flow rate

          Variables
          Pre-intervention

          Mean ± SD
          Post-intervention

          Mean ± SD
          p-value*

          Between groups
          p-value**

          Plaque index

          1-week 1.52 ± 1.53 0.62 ± 0.75 <0.001
          <0.0012-week 1.39 ± 1.40 0.92 ± 1.04 <0.001

          Control 1.50 ± 1.35 1.47 ± 1.36 0.237
          Tongue coating index

          1-week 5.92 ± 3.51 2.11 ± 2.86 <0.001
          <0.0012-week 5.14 ± 1.95 4.74 ± 2.21 0.215

          Control 4.68 ± 1.89 4.66 ± 1.90 0.323
          Gingival index

          1-week 2.76 ± 3.76 0.57 ± 2.04 <0.001
          <0.0012-week 2.65 ± 5.09 1.55 ± 3.45 0.002

          Control 5.02 ± 5.91 5.11 ± 5.81 0.781
          Salivary flow rate

          1-week 1.07 ± 1.30 1.50 ± 1.55 <0.001
          <0.0012-week 3.35 ± 0.49 3.61 ± 0.82 0.007

          Control 3.11 ± 0.40 3.02 ± 0.40 0.001
          *p-values were calculated using a paired t-test.
          **p-values of SFR were calculated using ANOVA and the remainder with ANCOVA.

          The Journal of Dental Hygiene 38 Vol. 94 • No. 6 • December 2020

          results of continued care. Future studies should evaluate the
          effects of implementing the program over a longer time frame.

          Limitations of this study include the small sample size and
          the possible inaccuracy of participant information related to
          general and oral health-related characteristics as obtained from
          the nursing staff responsible for the elderly resident. Future
          research should aim to enhance the sample both in size and
          representativeness.

          Conclusion
          Results from this study demonstrated that the

          implementation of a professional oral health care program
          enhances the oral health and salivation in the elderly.
          Accordingly, oral health professionals, dentists, and dental
          hygienists, should monitor and manage oral health of the
          elderly in long-term care facilities. Relevant guidelines
          for institutions need to be established requiring daily oral
          hygiene care and regular dental care to elderly residents in
          nursing homes.

          Disclosure
          This study was supported by a National Research

          Foundation of Korea grant funded by the Korean government
          (Ministry of Science and ICT; No. 2018R1A2B6006701).
          The funders had no role in the study design, data collection
          and analysis, or preparation of the manuscript.

          Kyeong Hee Lee, RDH, PhD is an associate professor,
          Department of Dental Hygiene, College of Bioecological
          Health, Shinhan University, Republic of Korea; Keun Yoo
          Lee, RDH, PhD is a medical consultation team leader, Asan-si
          Public Health Center, Republic of Korea; Yoon Young Choi,
          DDS, PhD is a research professor, Artificial Intelligence Big
          Data Medical Center, Yonsei University Wonju College of
          Medicine, Republic of Korea; Eun Seo Jung, RDH, PhD is an
          adjunct professor, Department of Dental Hygiene, College of
          Bioecological Health, Shinhan University, Republic of Korea

          Corresponding author: Eun Seo Jung, RDH, PhD;
          dentalmien@hanmail.net

          References
          1. Sung, K. Predictive factors associated with death of

          elderly in nursing homes. Asian Nurs Res. 2014 Jun; 8:
          143-9.

          2. Zenthöfer A, Rammelsberg P, Cabrera T, et al. Determinants
          of oral health-related quality of life of the institutionalized
          elderly. Psychogeriatrics. 2014 Dec; 14: 247-54.

          3. Tanigawa T, Yamashita J, Sato T, et al. Efficacy and
          safety of pilocarpine mouthwash in elderly patients with
          xerostomia. Spec Care Dentist. 2015 Feb; 35:164-9.

          4. Kwak JS, Woo SH, Lee JR. Recognition towards oral
          health care and plaque removal in the elderly people. J
          Korean Soc Dent Hyg. 2015 Aug; 15: 727-33.

          5. Ko SM, Lim SR. Oral hygiene care for elderly in care
          facility. J Korean Dent Assoc. 2015 Oct; 53: 678-87.

          6. Joen HS, Han SY, Chung WG, et al. Knowledge, attitude
          and behavior status on oral health care of geriatric care
          workers in long-term care facilities. J Dent Hyg Sci. 2015
          Oct; 15: 569-76.

          7. Kim GH, Kwon YS. A study on oral health perception
          and oral health-related quality of life of the elderly
          patients in a geriatric hospital. J Korean Soc Dent Hyg.
          2016 Jun; 16: 363-71.

          8. Jung ES, Choi YY, Lee KH. A qualitative study on the
          present conditions and problems of oral health care in
          senile dementia patients. J Korean Soc Dent Hyg. 2019
          Aug; 19: 601-14.

          9. Choi JS. Oral health status of long-term care facility
          residents. J Korean Soc Dent Hyg. 2017 Jun; 17: 527-37.

          10. Hoben M, Hu H, Xiong T, et al. Barriers and facilitators
          in providing oral health care to nursing home residents,
          from the perspective of care aides-a systematic review
          protocol. Syst Rev. 2016 Apr; 7: 53.

          11. Kim KM, Park YN, Lee MK, et al. Oral health knowledge
          level on oral care and elder oral hygiene care of the
          nursing home staff in long-term care facilities. J Korean
          Soc Dent Hyg. 2014 Oct; 14: 723-30.

          12. Baek JH, Lee HJ, Choi HJ, et al. Content analysis of
          daily tooth cleaning service records by caregivers in a
          long-term care facility. J Korean Soc Dent Hyg. 2014
          Dec; 14: 903-13.

          13. Choi SM. The effects of professional oral health care on oral
          health states of long-term care patients in geriatric hospital
          [dissertation]. Gyeongsan: Yeungnam University; 2012.

          14. Jeon YJ, Choi JS, Han SJ. The effect of dry mouth
          improvement by oral exercise program in elderly people.
          J Korean Soc Dent Hyg. 2012 Apr; 12: 293-305.

          15. Lee KY, Lim SR. Effect of professional oral healthcare
          program on the oral status of elderly residents in long-term
          care facilities. J Dent Hyg Sci. 2016 Dec; 16: 432-41.

          The Journal of Dental Hygiene 39 Vol. 94 • No. 6 • December 2020

          16. So JS. A study on the amendments of long-term care-
          related legislations for the introduction of part-time
          facility dentists. J Korean Dent Assoc. 2015 Oct; 53:
          696-704.

          17. Park JH, Kwon YC. Standardization of Korean version
          of mini-mental state examination (MMSE-K) for use
          in the elderly. Part II. Diagnostic validity. J Korean
          Neuropsychiatr Assoc. 1989 Mar; 28: 508-13.

          18. Jeong HY, Park BG, Shin HS, et al. Development of
          the Korean version of modified Barthel index (K-MBI):
          Multi-center study for subjects with stroke. Ann Rehabil
          Med. 2007; 31: 283-97.

          19. O’Leary TJ, Drake RB, Naylor JE. The plaque control
          record. J Periodontol. 1972 Jan; 43: 38.

          20. Winkel EG, Roldán S, Van Winkelhoff A, et al. Clinical
          effects of a new mouthrinse containing chlorhexidine,
          cetylpyridunium chloride and zinc-lactate on oral
          halitosis. A dual-center, double-blind placebo-controlled
          study. J Clin Periodontol. 2003 Apr; 30: 300-6.

          21. Löe H, Silness J. Periodontal disease in pregnancy I.
          Prevalence and Severity. Acta Odontol Scand. 1963 Dec;
          21: 533-51.

          22. Navazesh M, Christensen CM. A comparison of whole
          mouth resting and stimulated salivary measurement
          procedures. J Dent Res. 1982 Oct; 61: 1158-62.

          23. Vanobbergen JN, De Visschere LM. Factors contributing
          to the variation in oral hygiene practices and facilities in
          long-term care institutions for the elderly. Community
          Dent Health. 2005 Dec; 22: 260-5.

          24. Zuluaga DJ, Ferreira J, Montoya JA, Willumsen T. Oral
          health in institutionalised elderly people in Oslo, Norway
          and its relationship with dependence and cognitive
          impairment. Gerodontology. 2012 Jun; 29: e420–6.

          25. Shi Z, Xie H, Wang P, et al. Oral hygiene care for critically
          ill patients to prevent ventilator-associated pneumonia.
          Cochrane Database Syst Rev. 2013 Aug; 8: CD008367.

          26. Benn AM, Thomson WM. Saliva: an overview. N Z Dent
          J. 2014 Sep;110 :92-6.

          27. Matthews DC, Clovis JB, Brillant M, et al. Oral
          health status of long-term care residents: A vulnerable
          population. J Can Dent Assoc. 2012; 78: c3.

          28. Liccardo D, Cannavo A, Spagnuolo G, et al. Periodontal
          disease: a risk factor for diabetes and cardiovascular
          disease. Int J Mol Sci. 2019 Mar; 20: E1414.

          29. Villa A, Wolff A, Aframian D, et al. World Workshop
          on Oral Medicine VI: a systematic review of medication-
          induced salivary gland dysfunction: prevalence, diagnosis,
          and treatment. Clin Oral Investig. 2015 May; 19: 1563–80.

          30. Ohara Y, Yoshida N, Kono Y, et al. Effectiveness of an
          oral health educational program on community-dwelling
          older people with xerostomia. Geriatr Gerontol Int. 2015
          Apr; 15: 481-9.

          Copyright of Journal of Dental Hygiene is the property of American Dental Hygienists
          Association and its content may not be copied or emailed to multiple sites or posted to a
          listserv without the copyright holder’s express written permission. However, users may print,
          download, or email articles for individual use.

           Write the pathophysiology of the disease Cancer, include normal and abnormal pathophysiology of the impacted organ or body system, and the most common disease processes seen.This will include causes, prevalence, risk factors, population, and impacts of the disease process and include treatments. Do not re-write a textbook, do not copy and paste. This will be in your own words. Use APA format, 7th edition. This will be 3-4 typed pages excluding the title page and reference page.I need this in 16 hours 

          CLB 475 – Seminar
          Spring 2022

          Methodology

          Each student will describe the research design that will be used for their proposed research
          project.

          The methodology should be divided into the following sections:

          1. Design – Describe the type of experimental design that will be used for the study

          2. Variables – Describe the independent variable and dependent variable/s

          3. Participants – Describe the participants that you will recruit for this study
          a. Inclusion criteria
          b. Exclusion criteria

          4. Controls
          a. What are the characteristics of the control group?
          b. Will the control group receive any treatment (any variables manipulated)?
          c. Are there any ethical issues with the control group, and if yes, how will these be

          handled?

          5. Sampling
          a. Describe the sampling methods that will be used to select participants (e.g.,

          random, stratified random, systematic random, cluster)
          b. How large will your sample size be (number in experimental group and number in

          control group)?

          6. Validity and Reliability
          a. How will validity be ensured?
          b. How will reliability be ensured?

          7. Data Collection Technique – Describe the technique that will be used to obtain and
          collect the data

          a. What technique will be used?
          b. When and how will the data collection instrument be administered?

          8. Research Ethics – Describe the informed consent form that will be provided to each
          participant

          a. How will you ensure that participation is completely voluntary (voluntary, refusal
          to participate, withdrawal from study)?

          b. Are you providing any rewards to the participants?
          c. Does participation pose any risks to participants?
          d. How will you ensure confidentiality of the data?

          CLB 475 – Seminar
          Spring 2022

          The methodology should be 1 to 2 pages in length. It should be formatted in Times New Roman
          font, size 12, 1-inch margins, and double-spaced. All pages, except the cover page, should be
          numbered. Proper grammar and spelling are required.

          ______________________________________________________________________________

          Rubric for Assessment of Methodology:

          1. Design – 1 point

          2. Variables – 2 points

          3. Participants – 2 point

          4. Controls – 1 point

          5. Sampling – 1 point

          6. Validity and Reliability – 1 point

          7. Data Collection Technique – 1 point

          8. Research ethics – 1 point

          Civic Engagement

          Definitions of the civil engagement

          Civic engagement refers to how a person engages in a certain community and plays a positive impact into their life. (Hassan & Hamari, 2020). Another definition of the Civic engagement is defined as the action of an individual of collective people that is aimed at identifying a community gap and addressing it. (Fain, Munagala & Shah , 2018). There are many elements of civic engagement but the common are decision making, governance and also how the resources will be allocated. Based on the other definition, Civic engagement is the act of working of an individual or a group of people in order to make a certain difference in a given community. (Mirra ,2018) .In order to help a community, it requires a combination of an individual’s skills and knowledge.

          Having looked at the above three definitions of Civic engagement, according to my level of knowledge and skills. In my opinion, there are many benefits that result from civic engagement. Civil engagement can play an essential role in improving the relationship in the community as all the members in that community can develop a strong connection with one another. Civil engagement can help in growing and developing the community by providing the skills and knowledge thus making it better to adapt to their environment. Civil engagement can improve the quality of life as the community members can address their concerns and thus be able to influence the decision that can improve the quality of the life of the whole community.

          In my community, the problem that interferes with the public good is pollution. In recent years, there has been an increase in the population. This has led to the increase in waste products as there are no appropriate channels to dispose of the waste products. Environmental pollution, especially air pollution, has led to the emergence of many health problems. There are many diseases that arise as a result of environmental pollution. For example, an increase in the release of carbon dioxide results in acidic rainfall which devours the plants. Environmental pollution leads to an outbreak of water-borne diseases which is known to have killed many people all over the world.

          Based on the argument on pollution, It is one of the problems that affect the air which is a public good. Air plays an essential role in all living things. Without air, all the living things would have perished. Air pollution is the core cause of many diseases that humans experience. When harmful chemicals are released from the factories, they find their root in the atmospheres which eventually affect human beings in one way or another. There are many people in my society well-known for developing respiratory complications as a result of the air population.

          References

          Hassan & Hamari (2020). Gameful civic engagement: A review of the literature on gamification of e-participation. Government Information Quarterly, 37(3), 101461.

          Mirra (2018). Educating for empathy: Literacy learning and civic engagement. Teachers College Press.

          Fain, Munagala & Shah (2018, June). Fair allocation of indivisible public goods. In Proceedings of the 2018 ACM Conference on Economics and Computation (pp. 583).

          Please review the video with instructions regarding topic selection for the final paper. If you are unable to see the video, a transcript is attached. Once you select a topic, you will need to identify for your topic and write an outline of your research topic paper. This outline can follow the following format as far as section headings. But you do not have to follow it. You can add more sections. But there must be at least five sections highlighted by * and section titles. Include at least 100 words per section that you use.

          Abstract

          Introduction*

          Background

          Define your topic*

          Explain your topic*

          Defend your position about your topic*

          Conclusion*

          Summary

          Future Research Recommendation

          Incorporate at least one reference from articles listed within the online APUS library.

          •Written communication: Written communication is free of errors that detract from the overall message.
          •APA formatting: Resources and citations are formatted according to APA style and formatting.
          •Length of paper: typed, double-spaced pages with no less than two pages.
          •Font and font size: Times New Roman, 12 point

           

          2 of the theories from the list below to research in more detail:

          • Social Information Processing Theory
          • Hyper Personal Effect Theory
          • Warranting Theory
          • Social Identity Model of De-individuation Effects (also known as the SIDE mode

           

          Section 1

          • Summarize the first theory.
          • Provide 1 or 2 examples to illustrate the theory.
          • Explain how the theory complements the study of social or interpersonal psychology.

          Section 2

          • Summarize the second theory.
          • Provide 1 or 2 examples to illustrate the theory.
          • Explain how the theory complements the study of social or interpersonal psychology.

          Section 3

          • Compare and contrast the theories: How do they differ? How are they similar?

          Qualitative Approaches to Research

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Process of learning and constructing the meaning of human experience through intensive dialogue with persons who are living the experience
          • Rests on the assumption that there is a structure and essence to shared experiences that can be narrated

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Research question
          • Researcher’s perspective
          • Sample selection

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Data saturation- the situation of obtaining the full range of themes from the participants, so that in interviewing additional participants, no new data are emerging.

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Read the participants’ narratives
          • Extract significant statements
          • Formulate meanings for each of these significant statements
          • Repeat this process
          • Integrate the resulting themes
          • Reduce these themes to an essential structure
          • Return to the participants to conduct further interviews

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Inductive approach involving a systematic set of procedures to arrive at a theory about basic social processes
          • Widely used by social scientists, largely because it describes a research approach to construct theory where no theory exists or in situations where existing theory fails to provide evidence to explain a set of circumstances

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Identifying phenomena
          • Structuring the study
          • Data gathering
          • Data analysis
          • Theoretical sampling
          • Constant comparative method
          • Describing the findings

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Focuses on scientific description and interpretation of cultural or social groups and systems
          • The goal of the ethnographer is to understand the research participants’ views of their world, or the emic view.
          • Emic (insiders’) view differs from etic (outsiders’) view, which is obtained when the researcher uses quantitative analyses of behavior.

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • The view of the person experiencing the phenomenon and reflective of culture, values, beliefs, and experiences
          • What is it like to experience a particular phenomenon or to be part of a specific culture?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Use quotes from participants
          • Group concepts into themes
          • Themes: labels that assist the reader in understanding an experience from the emic (insiders’) perspective

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Trustworthiness describes the credibility and validity of qualitative research.
          • The researcher promotes trustworthiness by using quotes to illustrate the richness of the data and to establish a relationship between the themes identified and the data.

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Phenomenon of interest

          What is the phenomenon of interest, and is it clearly stated?

          What is the justification for using a qualitative method?

          What are the philosophic underpinnings of the research method?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Purpose

          What is the purpose of the study?

          What is the possible significance of the work to nursing?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Method

          Is the method used to collect data compatible with the purpose of the research?

          Is the method adequate to address the phenomenon of interest?

          If a particular approach is used to guide the inquiry, is the study completed according to the processes described?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Sampling

          What type of sampling is used? Is it appropriate given the particular method?

          Are the participants who were chosen appropriate to inform the research?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Data collection

          Are data focused on human experience?

          Does the researcher describe data collection strategies (e.g., interview, observation, field notes)?

          Is protection of participants addressed?

          Is saturation of the data described?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Data analysis

          What strategies are used to analyze data?

          Are steps described for data analysis followed?

          Are credibility, auditability, and fittingness of the data described?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Credibility

          Do the participants recognize the experience as their own?

          Has adequate time been allowed to understand the phenomenon fully?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Auditability

          Can the reader follow the researcher’s reasoning?

          Does the researcher document the research process?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          Definition: criterion of scientific rigor for qualitative research when the research report leads the reader from the research question and raw data through the steps of analysis and interpretation of the data

          *

          • Fittingness

          Are the findings applicable to other, similar situations?

          Are the results meaningful to nursing?

          Is the strategy used for analysis compatible with the purpose of the study?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Findings

          Are the findings presented within a context?

          Is the reader able to comprehend the “essence of the experience” from the report?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Findings

          Are the researcher’s conceptualizations (themes) true to the data?

          Does the researcher place the report in the context of what is already known?

          Was the existing literature on the topic related to the findings?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Conclusions, implications, and recommendations

          Do the conclusions, implications, and recommendations give a context to use the findings?

          Do the conclusions reflect the study findings?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          • Conclusions, implications, and recommendations

          What are the recommendations for future study? Do they reflect the findings?

          How has the researcher made explicit the significance to nursing theory, research, or practice?

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Phenomenology

          Grounded theory

          Ethnography

          Case study

          Community-based participatory research

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          *

          Copyright © 2014, 2010, 2006, 2002, 1998, 1994, 1990, 1986 by Mosby, an imprint of Elsevier Inc.

          ANSWER: E

          RATIONALE: Community-based participatory research (CBPR). Change or action is the intended “end-product” of CBPR, and action research is a term related to CBPR.

          *

          what is the impact COVID-19 might have on cancer .and its effects on the body system, including treatments, long-term effects, and emergency issues. Use only reputable sources such as CDC, ANA, and NCSBN. The NCSBN website has numerous posts regarding COVID-19. Write in two pages and at least two references. In APA format 7.I need this in 16hours. write in 500 words.

          Assignment 3 Rubric & Answers – Perry

          Question

          Answers

          Possible Points

          1.

          Is the study population identified and described? Are eligibility criteria specified?

          –

          –

          Study Population

          5

          Eligibility criteria

          5

          2.

          Dependent variable

          6

          3.

          Independent variable

          6

          4.

          What approach do the authors use to establish content validity?

          Content validity is the “degree to which an instrument has an appropriate sample of items for the construct being measured and adequately covers the construct domain.” To ensure a “content-valid” instrument, researchers should start with a conceptualization of the construct. This can be based on:

          · First-hand knowledge

          · Literature review

          · Expert consultations

          · Preliminary qualitative studies

          6

          5.

          What type of sampling plan was used? Would an alternative sampling plan have been preferable? Was the sampling plan one that could be expected to yield a representative sample?

          –

          –

          Sampling plan.

          5

          Alternative sampling plan

          2

          Sampling plan yielding representative sample

          2

          6.


          If sampling was stratified, was a useful stratification variable selected? If a consecutive sample was used, was the time period long enough to address seasonal or temporal variation?

          –

          –

          Stratification

          1

          Consecutive sampling

          1

          7.


          If cluster sampling was utilized, what were the clusters and how was sampling done within clusters?

          2

          8.

          How were people recruited into the sample? Does the method suggest potential biases?

          –

          –

          Recruitment

          4

          Potential biases

          4

          9.

          Did some factor other than the sampling plan affect the representativeness of the sample?

          5

          10.

          Are possible sample biases or weaknesses identified by the researchers themselves?

          5

          11.

          Are key characteristics of the sample described (e. g., mean age, percent female)? If yes, please provide detailed information on sample characteristics.

          12

          12.

          Was the sample size justified on the basis of a power analysis or other rationale?

          5

          13.

          What approach do the authors use to check for internal reliability?

          5

          14.

          What approach do the authors use to establish interrater reliability?

          2

          15.

          What approach do the authors use to establish test-retest reliability?

          2

          16.

          What approach do the authors use to establish discriminant validity?

          Discriminant validity is “the ability to differentiate a construct from other similar constructs.”

          5

          17.

          Does the sample support inferences about external validity? To whom can the study results reasonably be generalized?

          –

          –

          External validity

          5

          Generalizability

          5

          Source: Nursing Research: Generating and Assessing Evidence for Nursing Practice, 9th edition, p. 289.


          In this research on cancer add diagnostic testing used to confirm the diagnosis, enhance treatment options, or monitor prognosis. Must include lab tests including normal and out-of-range results that confirm or rule out the diagnosis, including blood gases. Please include the progression of those results— for example if the patient has high potassium and kayexalate is ordered and given what would you expect the potassium result to do? Also, use any x-ray and other imaging tests. Write in APA format 7 edition. 2 pages .Need this in 18 hours.

          Read the article titled: “Social Capital and Health Care Experiences among Low-Income Individuals” (attached in the Articles section). Critique the study’s sampling design by answering the attached questions (make sure not to answer with a yes/no; elaborate on each answer by describing what the authors did). Please use the attached word document template to add your answers to.

           Scenario:  

          Testing the Solution: Training and education:  Employees need to be educated on how to protect customers’ information.  

          1. As a team, determine how you will present insights from your research plan and your test results.
          2. Analyze your Strategic Integration Plan for any weaknesses: Does it provide the solution(s) needed? Make recommendations for improving the solutions(s) within the plan to better address a broader context of your emerging technology problem.
          3. Present the results of your test as organized information. Provide a brief summary of the action steps needed to strengthen your solution. Clearly indicate team members’ contributions.

          Two industries: Telecom and Finance

          Now that your team has crafted a Strategic Integration Plan, it’s time to test your solution. To examine your solution’s potential beyond a specific industry, your team will create a research plan that prepares you to test your solution by considering its usefulness beyond the original context you were given.

          When you chose your team problem at the beginning of this course, you were provided with a hypothetical organization to use as context for solving the problem. However, not all organizations you will work for in the future will narrowly fit into one organization or industry. Work through the following steps to draft your research plan.

          1. Identify two other industries or types of business likely to be affected by your team’s problem. Support your choices with research (cited in APA format).
          2. What strengths and weaknesses does a broader context provide to your proposed Strategic Integration Plan?
          3. Does context dramatically alter your overall strategy or detailed implementation plan?

          1

          EDITORIAL

          Articulating Your Philosophy of Nursing

          As the profession of nursing is dealing with rapid
          changes in knowledge and practice, the specialty of
          school nursing is attempting to articulate its value in
          the educational setting. Both the profession and spe-
          cialty are maturing, and along with this natural pro-
          cess, nurses are clarifying their roles and scope of prac-
          tice. As nurses examine their practice, they also are
          questioning what is fundamentally important to them
          as nurses and as individuals-their values and beliefs.
          This has become particularly critical as more and more
          nurses in all settings are finding that changing de-
          mands and expectations of the role are greater than
          the resources or number of hours in the day to accom-
          plish what nurses would define as quality nursing
          care. Such demands are pushing nurses to examine
          their values and what drew them to the profession of
          nursing in search of balance and meaning in the work
          setting.
          One strategy nurses can use to affirm that their

          practice is in harmony with their value system is to
          write a personal philosophy statement. This might be
          general in nature, such as a philosophy that relates to
          life values; it could be a philosophy statement related
          to beliefs about the profession of nursing; or it might
          be a philosophy specific to school nursing. In each
          case, this activity will encourage nurses to clarify their
          values and then examine how their philosophy fits
          with their professional practice. Articulating a philos-
          ophy statement is an intellectual activity that requires
          careful thought, because values need to be identified,
          clarified, and prioritized. Once these values are iden-
          tified, putting them together into a short, cohesive
          statement is a challenging process (Chitty, 2001).

          The first part of the process is identifying general
          values-values related to the nature of humankind
          and society. These are the core values held by an in-
          dividual, which are few in number but may evolve as
          individuals mature and society changes. Examples of
          these core values may relate to the dignity of man, the
          sanctity of life, or values that give direction to our
          journey of life. Personal values are influenced by fam-
          ily, culture, religious orientation, education, and the
          choice of one’s life work. All of these factors contrib-
          ute to who we are, what we believe, and more impor-
          tantly, how we act.

          Next, values that relate to the profession of nursing
          are delineated. Ideas may come from the American
          Nurses’ Association’s code for nurses (American Nurs-
          es’ Association, 1985) or the Standards o f Professional
          School Nursing Practice (National Association of School
          Nurses, 1998) and may include such themes as caring,
          confidentiality, integrity, accountability, competence,
          and improving the quality of care. Other important
          values of the nursing profession are altruism, ethics,
          and professionalism. In addition, the roles nurses per-
          form are often integrated into philosophy statements.
          Examples are caregiver, advocate, collaborator, case
          manager, health educator, counselor, leader, and re-
          searcher. Themes specific to school nursing relate to
          the population served-children, families, and staff-
          and the settings where care is delivered-the school
          and the community. Specific goals of school nursing
          may be articulated and include the prevention of dis-
          ease, the promotion and maintenance of health, and
          creation of an optimal environment for learning. Oth-
          er important ideas are issues in today’s society related
          to the allocation of resources and the delegation of
          care.

          Finally, the philosophy statement should end with
          a few sentences of how personal values articulate with
          values about nursing. Concluding statements could re-
          late to striving for balance and profession growth
          through continued learning. Caring for oneself as well
          as others is a critical issue for busy nurses, as is being
          a good role model for health in our homes, schools,
          and communities. The final statement often relates to
          how you hope to make a difference-in yourself or in
          your home, school, community, or the world.
          My first experience in articulating a philosophy of

          nursing was when I was completing a master’s degree
          in nursing of children. A class assignment forced me
          to synthesize my personal beliefs with what I had
          learned about caring for children and families. Al-
          though the requirements were for a short statement,
          the time taken to list these values and then organize
          them into a cohesive whole was daunting. What re-
          sulted was a meaningful statement that I still share
          with students today, 30 years later. This experience has
          inspired me to challenge others to take the same step
          and create their own personal philosophy of nursing.

          by guest on August 11, 2016jsn.sagepub.comDownloaded from

          2

          Through the years I have assigned graduate stu-
          dents in my nursing education and child health nurs-
          ing classes to write their own philosophy of nursing
          education or child health nursing. Most find this as-
          signment a meaningful part of their professional
          growth and an appropriate capstone experience at the
          end of their master’s degree program. More recently, I
          have been teaching a course on the Art and Science of
          Nursing to beginning nursing students and have re-
          quired them to write a philosophy of nursing. Their
          enthusiasm and ability to capture the essence of nurs-
          ing and the many roles nurses perform in today’s
          health care system have been amazing, considering
          the point where they are in their career. As they com-
          plete their baccalaureate program, students will have
          an opportunity to update or rewrite their philosophy
          as they enter the profession of nursing.

          The box below has a short philosophy of life I re-
          cently created to provide students an example on how
          to capture some personal beliefs on paper. It pulls to-
          gether some of the priorities that influence both my
          personal and professional life. Writing these down has
          helped me refocus my energies on what is really im-
          portant to me, especially at a time when competing
          demands often overshadow important values and how
          my time is used.

          Readers, I encourage each of you to take some time
          as we enter a new year to create your personal philos-
          ophy of nursing. Consider the ideas presented in this
          editorial as a starting point in identifying what is im-
          portant to you. Next, pull these ideas together in a
          short statement that reflects your personal and pro-
          fessional values. Each philosophy statement will be
          uniquely you. It may not be perfect or all inclusive,
          but it is an effort to clarify what you believe. As you

          review your philosophy, seriously consider how this
          statement will guide your practice as a school nurse.
          When you complete your philosophy, I encourage you
          to send me a copy. If I have a good response, I will
          share some of your ideas in a future editorial.

          Like life, a statement of philosophy is a work in
          progress. It is ever changing as we change and as the
          world around us changes. Saving earlier versions pro-
          vides evidence of our personal and professional
          growth over the years. Making the effort to articulate
          your values in a one-page statement is a valuable

          learning strategy for nurses today as we strive to pro-
          vide the best quality care to children and families. Fre-
          quently it gives us an opportunity to really examine
          what we believe and how this fits with our personal
          and professional lives. When there is not congruence
          between one’s philosophy and one’s personal or pro-
          fessional life, it provides the motivation to reconcile
          these differences. The development of a personal phi-
          losophy is an opportunity to explore what we believe.
          It is an inspiring, growth-producing experience. A phi-
          losophy statement expresses our unique values and
          goals that ultimately guide our practice as professional
          nurses.

          Janice Denehy, RN, PhD, Executive Editor

          REFERENCES

          American Nurses’ Association. (1985). Code for nurses with inter-
          pretive statements. Washington, DC: Author.

          Chitty, K. K. (2001). Professional nursing: Concepts and challenges
          (3rd ed.). Philadelphia: WB Saunders.

          National Association of School Nurses. (1998). Standards of profes-
          sional school nursing practice. Scarborough, ME: Author.

          by guest on August 11, 2016jsn.sagepub.comDownloaded from

          O R I G I N A L R E S E A R C H

          Effects of Domiciliary Professional Oral Care for
          Care-Dependent Elderly in Nursing Homes – Oral
          Hygiene, Gingival Bleeding, Root Caries and
          Nursing Staff’s Oral Health Knowledge and
          Attitudes

          This article was published in the following Dove Press journal:
          Clinical Interventions in Aging

          Caroline
          Girestam Croonquist1,2

          Jesper Dalum 3

          Pia Skott1,2

          Petteri Sjögren4

          Inger Wårdh2,3

          Elisabeth Morén 3

          1Folktandvården Stockholm AB,
          Stockholm, Sweden; 2Academic Centre
          Of Geriatric Dentistry, Stockholm,
          Sweden; 3Department Of Dental
          Medicine, Karolinska Institutet,
          Huddinge, Sweden; 4Oral Care AB,
          Stockholm, Sweden

          Purpose: The primary aim was to describe the effects for nursing home residents of monthly
          professional cleaning and individual oral hygiene instruction provided by registered dental
          hygienists (RDHs), in comparison with daily oral care as usual. The secondary aim was to
          study the knowledge and attitudes among nursing staff regarding oral health care and needs.
          Patients and Methods: In this randomised controlled trial (RCT), 146 residents were
          recruited from nine nursing homes in Regions of Stockholm and Sörmland and were
          randomly assigned (on nursing home level) to either intervention group (I; n=72) or control
          group (C; n=74). Group I received monthly professional cleaning, individual oral hygiene
          instructions and information given by an RDH. Group C proceeded with daily oral care as
          usual (self-performed or nursing staff-assisted). Oral health-related data was registered with
          the mucosal-plaque score index (MPS), the modified sulcus bleeding index (MSB), and root
          caries. The nursing staff’s attitudes and knowledge were analysed at baseline and at six-
          month follow-up. Statistical analysis was performed by Fisher’s exact test and two-way
          variance analysis (ANOVA).
          Results: Improvements were seen in both Group I and Group C concerning MPS, MSB and
          active root caries. The nursing staff working with participants in Group I showed significant
          improvements regarding the Nursing Dental Coping Beliefs Scale (DCBS) in two of four
          dimensions, oral health care beliefs (p=0.0331) and external locus of control (p=0.0017)
          compared with those working with Group C. The knowledge-based questionnaire showed
          improvement (p=0.05) in Group I compared with Group C.
          Conclusion: Monthly professional oral care, combined with individual oral health care
          instructions, seems to improve oral hygiene and may reduce root caries among nursing home
          residents. This may also contribute to a more positive attitude regarding oral hygiene
          measures among nursing home staff, as compared with daily oral care as usual.
          Keywords: aged, residential facilities, nursing staff, dental care, attitude of health personnel,
          oral health

          Introduction
          With an ageing population, the need for care support for dependent elderly
          increases for the general public.1 Domiciliary dental care enables dental services
          in the patients’ residences and offers the opportunity to provide regular check-ups,

          Correspondence: Elisabeth Morén
          Department Of Dental Medicine,
          Karolinska Institutet, Box 4064, Huddinge
          141 04, Sweden
          Tel +46 70 165 88 03
          Email elisabeth.moren@ki.se

          Clinical Interventions in Aging Dovepress
          open access to scientific and medical research

          Open Access Full Text Article

          submit your manuscript | www.dovepress.com Clinical Interventions in Aging 2020:15 1305–1315 1305

          http://doi.org/10.2147/CIA.S236460

          DovePress © 2020 Girestam Croonquist et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.
          com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By

          accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly
          attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).

          C
          lin

          ic
          a

          l I
          n

          te
          rv

          e
          n

          tio
          n

          s
          in

          A
          g

          in
          g

          d
          o

          w
          n

          lo
          a

          d
          e

          d
          f

          ro
          m

          h
          tt

          p
          s:

          //
          w

          w
          w

          .d
          o

          ve
          p

          re
          ss

          .c
          o

          m
          /

          o
          n

          0
          8

          -F
          e

          b
          -2

          0
          2

          2
          F

          o
          r

          p
          e

          rs
          o

          n
          a

          l u
          se

          o
          n

          ly
          .

          preventive measures and dental treatments to individuals
          who experience difficulties attending a regular dental
          clinic.2 The dental care performed at home by dental
          personnel is rudimentary, with rather simple equipment
          and treatments like scaling of calculus, tooth extractions,
          tooth restorations, adjustments of dentures and plaque
          removal.3 A study conducted by Wårdh et al (2012)3

          regarding nursing staff’s knowledge and attitudes towards
          oral health care showed that the majority of the nursing
          staff believed that the residents would tell them when they
          needed help with their daily oral hygiene. Furthermore, the
          majority felt that performing assisted oral care (tooth-
          brushing, interproximal tooth cleaning and/or cleaning of
          prothesis) was a difficult task and 80% thought the greatest
          obstacle was the non-cooperation from the residents.
          Keboa et al (2019) presented, from a nursing staff per-
          spective on performing assisted oral care, that challenges
          lie in complicated teeth constructions, high workload,
          resistance towards examine another person’s oral cavity/
          mouth, and not wanting to performed assisted oral care.4

          Residents at nursing homes may face difficulties visiting
          a dental clinic,5 and a study by Muszalik et al (2015)6 of
          patients visiting a geriatric clinic showed that elderly per-
          sons often have difficulties participating in activities outside
          their home environment. The major issues were the lack of
          energy and the presence of pain. Today, elderly in devel-
          oped countries retain their teeth at a higher age,7–9 but
          ageing with increased morbidity and polypharmacy often
          results in frailty and dependence on the care of others, all of
          which increase the risk of deterioration of oral health and
          susceptibility to developing oral diseases.10,11 The rela-
          tively high number of natural teeth and complicated oral
          prosthetic constructions (eg, bridges, crowns and oral
          implants),7,12,16 together with progressing morbidity and
          care dependence, necessitates that daily oral hygiene activ-
          ities need to be maintained on a sufficient level, or even
          intensified.7 The presence of oral health conditions can
          cause pain, infections and nutritional difficulties.7,8 The
          common condition oral dryness increases the risk of dental
          caries, which can relatively rapidly lead to deterioration of
          oral health.13,14 Additionally, it can cause a social handicap
          since oral dryness can lead to difficulties speaking, chewing
          and swallowing, impairment in tasting,14,15 and have
          a negative impact on quality of life.14,16,17

          Oral and general health are strongly related in older
          individuals16,18 and maintained oral health among the
          elderly has been related to retained general health.19,20

          A study conducted by Hagglund et al (2019)12 showed

          that the mortality risk observed over one year was signifi-
          cantly higher in older individuals with poor oral health
          than in those with good oral health. Furthermore, it has
          been shown that intensified oral care interventions by
          dental personnel may prevent approximately one in ten
          deaths from healthcare-associated pneumonia (NNT
          8.6–11).21 Both natural teeth and dentures may constitute
          a reservoir for respiratory pathogens,22 and denture wear-
          ing at night doubles the risk of healthcare-associated pneu-
          monia in the oldest adults.23 Barbe et al (2019)24

          concluded that professional cleaning performed by
          a dental nurse every two weeks on residents living at
          nursing homes maintained and improved the residents’
          oral health. Furthermore, domiciliary dental care provides
          the possibility of reaching individuals with, for example,
          cognitive impairment and/or functional limitations.19,25

          The primary aim of this study was to describe the
          effects for nursing home residents of professional cleaning
          and individual oral hygiene instruction provided by regis-
          tered dental hygienists (RDHs), in comparison with daily
          oral care as usual. The secondary aim was to study the
          knowledge and attitudes among nursing staff regarding
          oral health care and needs.

          The hypothesis was that domiciliary prophylactic pro-
          fessional oral care will improve oral health among partici-
          pants in the intervention group, in comparison with
          participants in a control group that receives daily oral
          care as usual.

          Materials and Methods
          This evaluator-blinded RCT with an open-ended design
          was performed at nine Swedish nursing homes. One hun-
          dred and forty-six residents were recruited to participate in
          the study; 72 were randomised to the intervention group
          (Group I) and 74 to the control group (Group C).

          Ethical Statement
          The study was approved by the Ethics Committee in
          Stockholm, Sweden (Number 2015/1641-31/2) and was
          registered in ClinicalTrial.gov (Number NCT02669979).

          Randomisation and Recruitment of the
          Nursing Homes
          Four nursing homes in Region Stockholm and five nursing
          homes in Region Sörmland were recruited to the study.
          Randomisation was performed at nursing home level.26

          The nursing homes were chosen geographically (urban and

          Girestam Croonquist et al Dovepress

          submit your manuscript | www.dovepress.com

          DovePress

          Clinical Interventions in Aging 2020:15 1306

          Powered by TCPDF (www.tcpdf.org)

          rural areas) and were managed by both private companies
          and municipalities. Approval from the head of the nursing
          home was mandatory for inclusion in the study. After col-
          lecting informed consent (for residents showing signs of
          reduced cognitive function according to Pfeiffer-test,27

          informed consent was required from either a relative or an
          advocate), the randomisation of the nursing homes to either
          Group I or Group C was decided by a computer-generated
          sequence and administrated by a coded letter representing
          each nursing home. The letter was opened by an RDH not
          otherwise involved in the clinical examinations in the study.

          The inclusion criteria were living in a nursing home,
          ≥85 years of age, and at least ten remaining teeth including
          dental implants. Exclusion criteria were having full den-
          tures, edentulous, reduced cognitive function that made
          cooperation impossible for examination and treatment by
          RDHs, extreme dry mouth assessed by the mirror-sliding
          friction test28 and ASA risk qualification of 4 or higher.29

          The taking of antiplatelet drugs and anticoagulants was not
          an exclusion criterion but was noted in the study protocol
          during data collection.

          Study Process
          At baseline, participants in both study groups received
          professional cleaning (tooth brushing, interproximal clean-
          ing and scaling of supragingival calculus) performed by
          three calibrated and blinded RDHs. Home care instructions
          regarding oral hygiene were given verbally and in writing
          to participants in both study groups and to nursing staff,
          and fluoridated toothpaste, a soft toothbrush and interprox-
          imal cleaning aids were given free of charge.

          Intervention
          The participants in Group I received monthly professional
          cleaning, individual oral hygiene instructions and informa-
          tion by RDHs (not otherwise involved in the oral exam-
          ination and study protocol registration). The visiting time
          was approximately 30 minutes.

          Control
          The participants in Group C received the same baseline
          procedure as Group I and proceeded with daily oral care as
          usual, performed either by themselves or assisted by nur-
          sing staff, throughout the study, without any additional
          visits or instructions by a study RDH.

          Oral Examination and Study Protocol
          Oral examination was performed by using a flashlight, mir-
          ror and probe at baseline and the results were registered in
          a study protocol (available on request) together with med-
          ical history and medication use. Indexes used were the
          mucosal-plaque score index (MPS),30 modified sulcus
          bleeding index (MSB)31 and root caries. Oral mouth dry-
          ness was measured by the participants’ subjective experi-
          ences and the mirror-sliding friction test28 on the inside of
          the buccal mucosa. Registrations according to the study
          protocol were performed in both groups by the three cali-
          brated RDHs at baseline, after three months and after six
          months (Figure 1).

          Indexes
          MPS is a combined mucosal score and plaque score index
          used both for edentulous and dentate individuals. Before
          oral measurements, dental prostheses were removed if
          present. Mucosal score (MS) rates changes in the oral

          Figure 1 Flow chart over clinical registrations according to the study protocol, the total number of residents and also for the intervention group (I) and the control group
          (C) throughout the study. From baseline to the end of the study at six-month follow-up. Instruments: Mucosal and plaque score index (MPS), modified sulcus bleeding index
          (MSB) and root caries.

          Dovepress Girestam Croonquist et al

          Clinical Interventions in Aging 2020:15 submit your manuscript | www.dovepress.com
          DovePress

          1307

          Powered by TCPDF (www.tcpdf.org)

          mucosa, and plaque score (PS) rates the amount of plaque
          both on natural teeth and on removable dentures and fixed
          prosthodontics. MS and PS are rated from 1 to 4 (4 is the
          most severe). By interpretation of the index, MS and PS
          are combined. The purpose of the index is to validate oral
          hygiene and not to serve as a diagnosis.30

          MSB was used to measure bleeding from the gingival
          margin on the buccal surface of the Silness-Loe index
          teeth12,16,24,32,36,44 or, when missing, the closest tooth32

          was assessed according to MSB, which has four levels
          (0–3) where 3 is the most severe.31

          Root caries33 was assessed according to five levels on
          the buccal surface on Silness-Loe index teeth.

          Nursing Staff
          Nursing staff from four nursing homes participated in this
          part of the study, with a total of 50 participants included.
          The intervention group contained 35 participants at base-
          line and 20 participants at six-month follow-up. The con-
          trol group contained 15 participants at baseline and 15
          participants at follow-up. Twelve participants from the
          intervention group and 2 participants from the control
          group could be followed using a four-digit code number
          from baseline to six-month follow-up and were therefore
          designated as the identified group.

          Study Process
          All nursing staff (nursing aides, assistant nurses, registered
          nurses and other staff such as administrators and man-
          agers) participated in an oral health education programme
          at study start, given by one RDH who was not otherwise
          involved in the study.

          Intervention
          The nursing staff’s knowledge and attitude towards oral
          health were registered prior to participating in the educa-
          tional programme at baseline using two questionnaires. The
          questionnaires were repeated at the six-month follow-up.

          Questionnaires
          The questionnaires used were the Nursing Dental Coping
          Belief Scale (Nursing DCBS)34 questionnaire and
          a knowledge-based questionnaire regarding oral health.35

          Both questionnaires were distributed to the current nursing
          staff working at the nursing homes that day, at baseline
          and at six-month follow-up. The questionnaires were pseu-
          donymised with a four-digit code number.

          The nursing DCBS index is a tool used to measure how
          groups of nursing staff differ in their priorities and how they

          meet their responsibilities for oral health care.34 The DCBS
          was developed by Jacobs & Stewart and is based on three
          major models of cognitive behavioural psychology consisting
          of Julian Rotter’s locus of control (divided into IL and EL),
          Albert Bandura’s self-efficacy and Donald Meichenbaum’s
          self-instructional technique.36 The DCBS consists of four
          dimensions: “internal locus of control (IL)”, “external locus
          of control (EL)”, “self-efficiency (SE)” and “oral health-care
          beliefs (OHCB)” and has been used in various types of care-
          related research.37 The IL dimension evaluates people’s self-
          control and self-experienced beliefs concerning events in life,
          for example, “I believe brushing can help prevent cavities”,
          and people with high degrees of IL expect themselves to have
          great control and responsibility over events in life. In contrast,
          people with high degrees of EL expect and believe that their
          lives are influenced by environmental factors outside their own
          control, for example, “No matter how hard I work on taking
          care of my teeth, I still get tooth decay”.36 The SE dimension
          evaluates people’s beliefs concerning their own capability to
          affect a specific situation,38 for example, “I believe I know
          how to brush my teeth correctly”.36 The OHBC dimension
          evaluates faulty and irrational beliefs about dental disease,38

          for example, “Once gum disease has started it is almost
          impossible to stop”.36 The responses in DCBS are listed on
          a scale, with five options ranging from “strongly agree” to
          “strongly disagree”, including a “do not know” option.34

          The Handbook of Healthcare was the second question-
          naire used in the study and is based on questions regarding
          knowledge about oral health needs in care-dependent
          elderly. It was retrieved from www.vardhandboken.se,
          which is a website that was initiated by the Swedish
          Association of Local Authorities and Regions to provide
          education and support to care providers. The questionnaire
          consists of nine questions about the use of dental pros-
          theses and how to clean them, oral dryness, oral hygiene
          performance, Revised Oral Health Assessment Guide
          (ROAG), etc. Each correct answer gives 1 point and zero
          points are awarded for incorrect answers.35

          Statistics
          The data collected at baseline were presented with mean
          values and standard deviations (SD) or as frequencies. The
          results were presented with changes from baseline to the
          three- and six-month follow-ups in frequency tables.
          Comparisons between Group I and Group C were made
          using Fisher’s exact test. P values <0.05 (95% CI) were
          considered statistically significant.

          Girestam Croonquist et al Dovepress

          submit your manuscript | www.dovepress.com

          DovePress

          Clinical Interventions in Aging 2020:15 1308

          Powered by TCPDF (www.tcpdf.org)

          Statistical methods used for the knowledge and attitude
          questionnaires were two-way variance analysis (ANOVA)
          and Fisher’s exact test.

          The participants (both the residents and the nursing
          staff) were treated as independent groups during analysis.
          The study was originally planned to last for one year but
          was concluded at six months due to financial reasons.

          Results
          Residents
          The mean number of natural teeth was 20.2 (SD 3.0) and 26%
          of the study participants received assisted oral care. Ninety-six
          percent had contact with dental care providers in the
          previous year. The mean prescribed medication was 9.7 (SD
          3.8) and 29% of the participants were registered with dry
          mouth according to self-experienced reports and the mirror-
          sliding friction test. A total of 14 participants used their electric
          toothbrush daily and strained food was medically prescribed
          for 3% of the participants. Additional baseline data are pre-
          sented in Table 1. Of the 146 included residents, a total of 124
          residents completed the entire study. Reasons for dropouts
          were events of death or hospitalization. There were more
          women than men in the total study material but no statistical
          difference between Groups I and C existed at baseline.

          Oral Hygiene and Root Caries
          MPS
          For MPS, improvements from baseline to six-month fol-
          low-up were seen in both Group I and Group C. Both

          groups showed improved PS, but without significance.
          For MS, a significant difference between Group I and
          Group C (p=0.04) was seen within the period between
          the three- and six-month follow-ups. In Group I, 20% of
          the participants showed improved MS, in comparison with
          13% in Group C (Tables 2–4).

          MSB
          The MSB index was combined and is presented as MSB 0
          +1 and MSB 2+3. For Group I and Group C, an improve-
          ment throughout the study could be seen within the groups
          (Table 5).

          Root Caries
          The root caries index was reduced from five levels to three
          and is presented as healthy (caries score of 1), initial caries
          lesion (caries score of 2 and 4) and active caries lesion
          (caries score of 3 and 5). Improvements were seen in both
          Group I and Group C for healthy and initial caries lesions
          throughout the study period, without significant difference
          between the groups. The last follow-up period between three
          to six months showed improvement for Group I regarding
          active caries lesions, with an improvement of 17% in com-
          parison with 4% in Group C (p=0.05) (Table 6–8).

          Nursing Staff
          The Nursing Staff’s Knowledge and Attitudes
          The intervention group showed a statistically significant
          improvement in comparison with the control group in the

          Table 1 Baseline Data For Residents

          Group I (n=72) Group C (n=74) Total (n=146)

          Age, mean value (SD) 89 (4.0) 88.7 (4.2) 88.9 (4.1)

          Men, n (%) 16 (22) 22 (29.7) 38 (26.0)

          Natural teeth, mean value (SD) 20.5 (2.9) 19.9 (3.1) 20.2 (3.0)
          Implants, n (%) 5 (6.7) 7 (9.5) 12 (8.2)

          Removable partial denture, n (%) 9 (12.5) 10 (13.5) 19 (13)

          Removable full denture, n (%) 1 (1.14) 0 (0) 1 (0.7)
          Got help with daily oral hygiene, n (%) 16 (22.2) 22 (29.7) 38 (26.0)

          Used fluoride toothpaste, n (%) 70 (97.2) 65 (87.8) 135 (92.5)

          Tooth brushing/day, mean value (SD) 1.7 (0.5) 1.8 (0.6) 1.8 (0.6)
          Interproximal cleaning/week, n (%) 30 (44.4) 30 (40.5) 60 (42.5)

          Used electric toothbrush, n (%) 9 (12.5) 5 (6.8) 14 (9.6)

          No dental exam/dental check-up > 12 months, n (%) 5 (6.9) 1 (1.4) 6 (4.1)
          Number of prescribed medications, mean value (SD) 9.8 (3.8) 9.5 (3.8) 9.7 (3.8)

          Dry mouth, n (%) 26 (36.1) 16 (21.6) 42 (28.8)

          Strained food, n (%) 2 (2.8) 3 (4.1) 5 (3.4)
          Nutritional drinks, n (%) 12 (16.7) 5 (6.8) 17 (11.6)

          Abbreviations: n, number; SD, standard deviation.

          Dovepress Girestam Croonquist et al

          Clinical Interventions in Aging 2020:15 submit your manuscript | www.dovepress.com
          DovePress

          1309

          Powered by TCPDF (www.tcpdf.org)

          OHCB dimension (p=0.03) and EL dimension (p=0.0017).
          In the identified group, there was a statistically significant
          difference in the IL dimension group (p=0.03).

          For the knowledge-based questionnaire, an improve-
          ment (p=0.05) was found between the intervention and
          the control group from baseline to six-month follow-up.

          Table 2 Plaque Score (PS) from Baseline (B) Among The Intervention (I) and Control (C) Group to Three- and Six-Month Follow-Ups

          PS B–3 Months B–6 Months 3–6 Months

          p-value 0.24 0.34 0.80

          I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

          Deteriorated n (%) 4 (5.71) 7 (11.48) 3 (4.35) 3 (5.45) 16 (23.19) 11 (20.00)

          Unchanged n (%) 33 (47.14) 21 (34.42) 40 (57.97) 25 (45.45) 44 (63.77) 35 (63.64)

          Improved n (%) 33 (47.14) 33 (54.10) 26 (37.68) 27 (49.09) 9 (13.04) 9 (16.36)

          Abbreviations: n, number of participants.

          Table 3 Mucosal Score (MS) from Baseline (B) Among the Intervention (I) and Control (C) Group to Three- and Six-Month Follow-
          Ups

          MS B–3 Months B–6 Months 3–6 Months

          p-value 0.10 0.12 0.04*

          I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

          Deteriorated n (%) 11 (15.71) 4 (6.56) 8 (11.59) 1 (1.82) 17 (24.64) 6 (10.91)

          Unchanged n (%) 22 (31.43) 29 (47.54) 31 (44.93) 28 (50.91) 38 (55.07) 42 (76.36)
          Improved n (%) 37 (52.86) 28 (45.90) 30 (43.48) 26 (47.27) 14 (20.29) 7 (12.73)

          Notes: *p <0.05. All other comparisons, not significant.
          Abbreviations: n, number of participants.

          Table 4 Mucosal And Plaque Score (MPS) from Baseline (B) Among the Intervention (I) and Control (C) Group to Three- And Six-
          Month Follow-Ups

          MPS B–3 Months B–6 Months 3–6 Months

          p-value 0.77 0.42 0.51

          I (n=70) C (n=61) I (n=69) C (n=55) I (n=69) C (n=55)

          Deteriorated n (%) 10 (14.29) 6 (9.84) 7 (10.14) 3 (5.45) 24 (34.78) 14 (25.45)

          Unchanged n (%) 13 (18.57) 13 (21.31) 24 (34.78) 16 (29.09) 30 (43.48) 29 (52.73)

          Improved n (%) 47 (67.14) 42 (68.85) 38 (55.07) 36 (65.45) 15 (21.74) 12 (21.82)

          Abbreviations: n, number of participants.

          Table 5 Modified Sulcus Bleeding Index (MSB) at Baseline (B), and After Three- And Six-Month (M) Follow-Ups and Difference (Diff)
          Between Time, Intervention (I) and Control (C) Group

          Baseline 3 Months Diff B–3M 6 Months Diff B–6M

          I n=72 C n=74 I n=70 C n=61 I n=70 C n=61 I n=69 C n=55 I n=69 C n=55

          MSB level 0–1

          mean (SD)

          2.07

          (1.70)

          1.66

          (1.12)

          2.15

          (1.70)

          1.79

          (0.94)

          0.08 0.13 2.41

          (1.76)

          2.30

          (1.14)

          0.34 0.64

          MSB level 2–3
          mean (SD)

          0.98
          (1.54)

          1.35
          (1.04)

          0.84
          (0.26)

          1.28
          (0.63)

          − 0.14 − 0.07 0.59
          (0.13)

          0.70
          (1.47)

          − 0.39 − 0.65

          Notes: MSB 0–1 positive values show improvement, MSB 2–3 negative values show improvement.

          Girestam Croonquist et al Dovepress

          submit your manuscript | www.dovepress.com

          DovePress

          Clinical Interventions in Aging 2020:15 1310

          Powered by TCPDF (www.tcpdf.org)

          Discussion
          The present study was a part of a project with the aim to
          evaluate regular professional cleaning and information/
          instructions regarding oral health care performed in nur-
          sing homes.2 It concluded that professional cleaning has
          a favourable effect on gingival bleeding, and verbally
          given individual oral hygiene instruction resulted in
          greater reduction of dental plaque, which indicates that
          both education and individual oral hygiene instruction
          with “hands-on” training ought to be included in domicili-
          ary oral health care programmes.2 In the present study, the
          intervention has therefore been a combination of these two
          parts. Furthermore, a root caries index and the knowledge
          and attitudes of nursing staff towards oral health care were
          added to the study design.
          <

          Discuss the individual and/or community needs as it relates to the reason for your capstone research inquiry. Why do you believe your research inquiry/findings will address the identified needs that prompted your inquiry?

          Instructions for Literature Review assignment:

          Based on the topic of interest, each student will write a literature review that describes the issue under study (problem statement), background information obtained from previous research studies conducted on this topic, the purpose of the proposed research study, the significance of the research study (knowledge gaps that need to be filled), and the research question and hypothesis of the study.

          The literature review should be 5to 7pages in length. It should be formatted in Times New Roman font, size 12, 1-inch margins, and double-spaced. All pages, except the cover page, should be numbered. Proper grammar and spelling are required.  

          AT LEAST five (5) primary references should be used. PDF versions of these references must be uploaded along with the literature review. All references (primary and secondary) should be formatted in APA format. References must be included as in-text citations in the body of the literature review and in the reference list at the back. The reference list does not count towards the page limit.

          i add the first revision bibliography

          i need to reorder the research question to 

          How biofilm affect the patient recovery at the hospital,

          and in the Annotated Bibliography has to be focus in What type of patient have biofilm 

          and what is biofilm and the general information

          Helpful APA Resources – Purdue University APA Formatting and Style Guide:

          a. Read the posted article above.

          b. Refer to Chapter 6 pages 120 to121  of your assigned textbook for more guidance. 

          c. Respond to the questions below by reviewing the article and identifying those elements (state the page number you found the element). If you indicate you support the researcher use of the element, make sure your findings are with literature (eg. you can reference your textbook where it says that element is important in qualitative research). 

          Your critique responses should reflect the following:
          1. What type of qualitative approach did the researcher use?
          2. what type of sampling method did the researcher use? Is it appropriate for the study?
          3. Was the data collection focused on human experiences?
          4. Was issues of protection of human subjects addressed?
          5. Did the researcher describe data saturation?
          6. What procedure for collecting data did the researcher use?
          7. What strategies did the researcher use to analyze the data?
          8. Does the researcher address credibility (can you appreciate the truth of the patient’s experience), auditability (can you follow the researcher’s thinking, does the research document the research process) and fittingness are the results meaningful, is analysis strategy compatible with the purpose of the study) of the data?

          9.  What is your cosmic question? (This is a question you ask your peers to respond to based on the chapter discussed in class this week i.e. Qualitative studies).

          Civic Engagement Term Project

          the “public good”/ “problem”from a microbiology perspective: Homelessness in San Francisco.

          Academic and Statistical Research [CLO 2]

          Find (at least) two different academic sources (e.g., journal articles) that provide insight into why your identified problem/issue is important in your community (e.g., rising costs of medications, vaccination rates in the community, understanding of antimicrobial substances by the community, etc.). For each article:

          1. Summarize the findings.

          2. State any statistics that are important to your problem.

          3. Critique the article with respect to to critical components (see below)

          4. Explain how this article relates to your problem.

          28 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

          ALL NURSES are expected to understand and
          apply evidence to their professional practice.
          Some of the evidence should be in the form
          of research, which fills gaps in knowledge,
          developing and expanding on current under-
          standing. Both quantitative and qualitative re-
          search methods inform nursing practice, but
          quantitative research tends to be more empha-
          sized. In addition, many nurses don’t feel
          comfortable conducting or evaluating qualita-
          tive research. But once you understand quali-
          tative research, you can more easily apply it to
          your nursing practice.

          What is qualitative research?
          Defining qualitative research can be challeng-
          ing. In fact, some authors suggest that provid-
          ing a simple definition is contrary to the
          method’s philosophy. Qualitative research ap-
          proaches a phenomenon, such as a clinical
          problem, from a place of unknowing and at-
          tempts to understand its many facets. This
          makes qualitative research particularly useful
          when little is known about a phenomenon
          because the research helps identify key con-

          Introduction to
          qualitative

          nursing
          research

          This type of research
          can reveal important

          information that
          quantitative

          research can’t.

          By Jennifer Chicca, MS, RN, CNE, CNE-cl

          STRICTLY CLINICAL RESEARCH 101

          MyAmericanNurse.com June 2020 American Nurse Journal 29

          cepts and constructs. Qualitative research sets
          the foundation for future quantitative or qualita-
          tive research. Qualitative research also can stand
          alone without quantitative research.

          Although qualitative research is diverse,
          certain characteristics—holism, subjectivity,
          intersubjectivity, and situated contexts—guide
          its methodology. This type of research stresses
          the importance of studying each individual as
          a holistic system (holism) influenced by sur-
          roundings (situated contexts); each person de-
          velops his or her own subjective world (sub-
          jectivity) that’s influenced by interactions with
          others (intersubjectivity) and surroundings (sit-
          uated contexts). Think of it this way: Each
          person experiences and interprets the world
          differently based on many factors, including
          his or her history and interactions. The truth is
          a composite of realities.

          Qualitative research designs
          Because qualitative research explores diverse
          topics and examines phenomena where little
          is known, designs and methodologies vary.
          Despite this variation, most qualitative re-
          search designs are emergent and holistic. In
          addition, they require merging data collection
          strategies and an intensely involved re-
          searcher. (See Research design characteristics.)

          Although qualitative research designs are
          emergent, advanced planning and careful
          consideration should include identifying a
          phenomenon of interest, selecting a re-
          search design, indicating broad data collec-
          tion strategies and opportunities to enhance
          study quality, and considering and/or setting
          aside (bracketing) personal biases, views,
          and assumptions.

          Many qualitative research designs are used
          in nursing. Most originated in other disci-
          plines, while some claim no link to a particu-
          lar disciplinary tradition. Designs that aren’t
          linked to a discipline, such as descriptive de-
          signs, may borrow techniques from other
          methodologies; some authors don’t consider
          them to be rigorous (high-quality and trust-
          worthy). (See Common qualitative research
          designs.)

          Sampling approaches
          Sampling approaches depend on the quali-
          tative research design selected. However, in
          general, qualitative samples are small, nonran-
          dom, emergently selected, and intensely stud-

          ied. Qualitative research sampling is con-
          cerned with accurately representing and dis-
          covering meaning in experience, rather than
          generalizability. For this reason, researchers tend
          to look for participants or informants who are
          considered “information rich” because they
          maximize understanding by representing
          varying demographics and/or ranges of expe-
          riences. As a study progresses, researchers
          look for participants who confirm, challenge,
          modify, or enrich understanding of the phe-
          nomenon of interest. Many authors argue that
          the concepts and constructs discovered in
          qualitative research transcend a particular
          study, however, and find applicability to oth-
          ers. For example, consider a qualitative study
          about the lived experience of minority nursing
          faculty and the incivility they endure. The
          concepts learned in this study may transcend
          nursing or minority faculty members and also
          apply to other populations, such as foreign-
          born students, nurses, or faculty.

          A sample size is estimated before a quali-
          tative study begins, but the final sample size
          depends on the study scope, data quality,
          sensitivity of the research topic or phenome-
          non of interest, and researchers’ skills. For ex-
          ample, a study with a narrow scope, skilled

          Most qualitative research designs share the following characteristics.

          Characteristic Description Example

          Emergent

          Holistic

          Intensely

          involved

          researcher

          Merging data

          collection

          strategies

          Research design characteristics

          • Flexible
          • Adaptable
          • Changes to
          reflect realities
          and viewpoints,
          which may not
          be known at the
          outset

          • Considers the
          whole

          • Detailed study

          • Many strategies
          are used to
          capture holism

          A researcher completing a ground-
          ed theory study changes the inter-
          view questionnaire, based on pre-
          liminary findings, to include more
          focused questions to help saturate
          theoretical categories

          A researcher completing a histori-
          cal research study analyzes arti-
          facts, journals, interviews, docu-
          ments, photographs, and records
          to understand a past event

          A researcher completing an ethno-
          graphic inquiry spends time
          (sometimes years) interviewing,
          observing, and perhaps even par-
          ticipating in the studied culture

          A researcher completing a case
          study analyzes interviews, observa-
          tions, documents, and records to
          understand the identified case

          30 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

          researchers, and a nonsensitive topic likely
          will require a smaller sample. Data saturation
          frequently is a key consideration in final sam-
          ple size. When no new insights or informa-
          tion are obtained, data saturation is attained
          and sampling stops, although researchers may
          analyze one or two more cases to be certain.
          (See Sampling types.)

          Some controversy exists around the con-
          cept of saturation in qualitative nursing re-
          search. Thorne argues that saturation is a con-
          cept appropriate for grounded theory studies
          and not other study types. She suggests that
          “information power” is perhaps more appro-
          priate terminology for qualitative nursing re-
          search sampling and sample size.

          Data collection and analysis
          Researchers are guided by their study design
          when choosing data collection and analysis
          methods. Common types of data collection in-
          clude interviews (unstructured, semistructured,

          focus groups); observations of people, envi-
          ronments, or contexts; documents; records; ar-
          tifacts; photographs; or journals. When collect-
          ing data, researchers must be mindful of
          gaining participant trust while also guarding
          against too much emotional involvement, en-
          suring comprehensive data collection and
          analysis, conducting appropriate data manage-
          ment, and engaging in reflexivity.

          Reflexivity involves systematically analyz-
          ing each step of the research process. Unlike
          quantitative researchers, who use validated in-
          struments, qualitative researchers themselves
          are the instruments. They must strive to attain
          and manage high-quality data. Journaling can
          help researchers identify and manage how
          their behaviors and thoughts influence their
          study findings. When researchers bracket their
          preconceived notions when collecting and an-
          alyzing data, they help increase study rigor.

          Data usually are recorded in detailed notes,
          memos, and audio or visual recordings, which

          Qualitative nursing research can take many forms. The design you choose will depend on the question you’re trying to answer.

          Design Originating discipline Description Sample nursing research question

          Action research Education Conducted by and for What happens to the quality of nursing practice
          those taking action to when we implement a peer-mentoring system?
          improve or refine actions

          Case study Many In-depth analysis of an entity How is patient autonomy promoted by a unit?
          or group of entities (case)

          Descriptive N/A Content analysis of data What is the nursing role in end-of-life decisions?

          Discourse analysis Many In-depth analysis of written, What discourses are used in nursing practice and
          vocal, or sign language how do they shape practice?

          Ethnography Anthropology In-depth analysis of a How does Filipino culture influence childbirth
          culture experiences?

          Ethology Psychology Biology of human behavior What are the immediate underlying psycho-
          and events logical and environmental causes of incivility
          in nursing?

          Grounded theory Sociology Social processes within a How does the basic social process of role
          social setting transition happen within the context of
          advanced practice nursing transitions?

          Historical research History Past behaviors, events, When did nurses become researchers?
          conditions

          Narrative inquiry Many Story as the object of How does one live with a diagnosis of
          inquiry scleroderma?

          Phenomenology Philosophy Lived experience What is the lived experience of nurses who were
          Psychology admitted as patients on their home practice unit?

          Common qualitative research designs

          MyAmericanNurse.com June 2020 American Nurse Journal 31

          frequently are transcribed verbatim and ana-
          lyzed manually or using software programs,
          such as ATLAS.ti, HyperRESEARCH, MAXQDA,
          or NVivo. Analyzing qualitative data is com-
          plex work. Researchers act as reductionists,
          distilling enormous amounts of data into con-
          cise yet rich and valuable knowledge. They
          code or identify themes, translating abstract
          ideas into meaningful information. The good
          news is that qualitative research typically is
          easy to understand because it’s reported in
          stories told in everyday language.

          Evaluating a qualitative study
          Evaluating qualitative research studies can
          be challenging. Many terms—rigor, validity,
          integrity, and trustworthiness—can describe
          study quality, but in the end you want to know
          whether the study’s findings accurately and
          comprehensively represent the phenomenon
          of interest. Many researchers identify a quality
          framework when discussing quality-enhance-
          ment strategies. Example frameworks include:
          • Trustworthiness criteria framework, which

          enhances credibility, dependability, con-
          firmability, transferability, and authenticity

          • Validity in qualitative research framework,
          which enhances credibility, authenticity, criti-
          cality, integrity, explicitness, vividness, creativ-
          ity, thoroughness, congruence, and sensitivity.
          With all frameworks, many strategies can

          be used to help meet identified criteria and
          enhance quality. (See Research quality en-
          hancement). And considering the study as a
          whole is important to evaluating its quality
          and rigor. For example, when looking for ev-
          idence of rigor, look for a clear and concise
          report title that describes the research topic
          and design and an abstract that summarizes
          key points (background, purpose, methods, re-
          sults, conclusions). (Visit myamericannurse.com/
          ?p=66448 to learn what other questions to ask
          when evaluating a qualitative study.)

          Application to nursing practice
          Qualitative research not only generates evi-
          dence but also can help nurses determine pa-
          tient preferences. Without qualitative research,
          we can’t truly understand others, including their
          interpretations, meanings, needs, and wants.
          Qualitative research isn’t generalizable in the
          traditional sense, but it helps nurses open their
          minds to others’ experiences. For example,
          nurses can protect patient autonomy by under-

          standing them and not reducing them to univer-
          sal protocols or plans. As Munhall states, “Each
          person we encounter help[s] us discover what is
          best for [him or her]. The other person, not us,
          is truly the expert knower of [him- or herself].”
          Qualitative nursing research helps us under-
          stand the complexity and many facets of a
          problem and gives us insights as we encourage
          others’ voices and searches for meaning.

          When paired with clinical judgment and
          other evidence, qualitative research helps us
          implement evidence-based practice success-
          fully. For example, a phenomenological in-
          quiry into the lived experience of disaster

          Several sampling types guide qualitative research, and because designs
          are emergent, sampling may change as a study progresses. In grounded
          theory, for instance, sampling moves into more focused theoretical sam-
          pling as a study progresses. The researcher may return to a participant
          and question him or her more specifically about a theoretical construct,
          such as the concept of “making it work” in a study about having a child
          with a disability. This sampling approach helps ensure theoretical cate-
          gories become saturated.

          Sampling type Comments

          Convenience or volunteer • Participants readily available
          • Easy, efficient
          • Might not be “information rich”

          Purposive • Participants selected because they
          benefit the study (for example,
          selecting for varying demographics or
          ranges of experience)

          Shadow • Participants speak of others’
          experiences in addition to their own

          Snowball or chain • Early participants refer others
          • Easy, efficient
          • Might not be “information rich”

          Theoretical • Participants selected based on
          manifestation of theoretical constructs

          Sampling types

          32 American Nurse Journal Volume 15, Number 6 MyAmericanNurse.com

          workers might help expose strengths and
          weaknesses of individuals, populations, and
          systems, providing areas of focused interven-
          tion. Or a phenomenological study of the
          lived experience of critical-care patients might
          expose factors (such dark rooms or no visible
          clocks) that contribute to delirium.

          Successful implementation
          Qualitative nursing research guides under-
          standing in practice and sets the foundation for
          future quantitative and qualitative research.
          Knowing how to conduct and evaluate quali-
          tative research can help nurses implement ev-
          idence-based practice successfully. AN

          Jennifer Chicca is a PhD candidate at the Indiana University of
          Pennsylvania in Indiana, Pennsylvania, and a part-time faculty
          member at the University of North Carolina Wilmington.

          References
          Amankwaa L. Creating protocols for trustworthiness in
          qualitative research. J Cult Divers. 2016;23(3):121-7.

          Cuthbert CA, Moules N. The application of qualitative
          research findings to oncology nursing practice. Oncol
          Nurs Forum. 2014;41(6):683-5.

          Guba E, Lincoln Y. Competing paradigms in qualitative

          research. In: Denzin NK, Lincoln YS, eds. Handbook of
          Qualitative Research. Thousand Oaks, CA: SAGE Publi-
          cations, Inc.;1994: 105-17.

          Lincoln YS, Guba EG. Naturalistic Inquiry. Thousand
          Oaks, CA: SAGE Publications, Inc.; 1985.

          Munhall PL. Nursing Research: A Qualitative Perspective.
          5th ed. Sudbury, MA: Jones & Bartlett Learning; 2012.

          Nicholls D. Qualitative research. Part 1: Philosophies. Int
          J Ther Rehabil. 2017;24(1):26-33.

          Nicholls D. Qualitative research. Part 2: Methodology.
          Int J Ther Rehabil. 2017;24(2):71-7.

          Nicholls D. Qualitative research. Part 3: Methods. Int J
          Ther Rehabil. 2017;24(3):114-21.

          O’Brien BC, Harris IB, Beckman TJ, Reed DA, Cook DA.
          Standards for reporting qualitative research: A synthesis
          of recommendations. Acad Med. 2014;89(9):1245-51.

          Polit DF, Beck CT. Nursing Research: Generating and
          Assessing Evidence for Nursing Practice. 10th ed.
          Philadelphia, PA: Wolters Kluwer; 2017.

          Thorne S. Saturation in qualitative nursing studies: Un-
          tangling the misleading message around saturation in
          qualitative nursing studies. Nurse Auth Ed. 2020;30(1):5.
          naepub.com/reporting-research/2020-30-1-5

          Whittemore R, Chase SK, Mandle CL. Validity in qualita-
          tive research. Qual Health Res. 2001;11(4):522-37.

          Williams B. Understanding qualitative research. Am
          Nurse Today. 2015;10(7):40-2.

          Several strategies can be used to enhance qualitative research quality.

          Quality-enhancement strategy Description

          Audit trial Transparently describing all research processes (data collection and analysis methods)

          Comprehensive field notes Recording thoughts, topics, etc., before, during, or after data collection

          Data saturation When no new insights or information are obtained and redundancy is achieved

          Member checking Sharing study results (themes, codes) with participants and obtaining critical feedback

          Peer review and debriefing Evaluating study processes and outcomes by peers (other investigators)

          Prolonged engagement and Spending sufficient time (scope) and focus (depth) in study efforts to gain complete
          persistent observation understanding of the phenomenon of interest (for example, through extended
          field observations)

          Recording transcription Transcribing audio and/or video recordings of data (for example, interviews,
          observations) verbatim

          Reflexivity Systematically analyzing all steps of the research process (for example, via journaling)

          Theoretical sampling Sampling on the basis of manifestation of theoretical constructs to further develop
          a theory

          Triangulation Obtaining and using multiple data sources, methods, investigators, theories, analysts

          Vivid descriptions Making the phenomenon studied explicit by providing detailed accounts

          Research quality enhancement

          Results

          The following graph tries to represent the behavior of the temperature, based on the warming of our planet over a period: incorporating the main idea investigated in each article and its relationship with. the subject studied by the researcher. You can see the increase in temperature. Chart, line chart, histogram Description automatically generated You can see the increase in temperature

          Method

          For this study, a meta-analysis method was used to synthesize different results found in some reviewed studies. An advanced internet search was carried out and keywords such as “global warming”, “climate change” and “forest fires” were used. Supposed to maintain updated information and reduce topics, the search was limited to research articles from the last five years, from 2018 to 2022. There was no limitation when searching literature in other languages, in an attempt not to limit our research. The search made provided access to multiple articles related to our topic, but only three were analyzed, For this study, a meta-analysis method was used to synthesize different results found in some reviewed studies. An advanced internet search was carried out and keywords such as “global warming”, “climate change” and “forest fires” were used. Supposed to maintain updated information and reduce topics, the search was limited to research articles from the last five years, from 2018 to 2022. There was no limitation when searching literature in other languages, in an attempt not to limit our research. The search made provided access to multiple articles related to our topic, but only three were analyzed, the rest were discarded. the rest were discarded.

           The final project is athree-partt activity. You will respond to three separate prompts but prepare your paper as one research paper. Be sure to include at least one school library source per prompt, in addition to your textbook (which means you’ll have at least 4 sources cited). Start your paper with an introductory paragraph. 

          Prompt 1 “Blockchain” (2-3 pages): Explain the major components of a blockchain. Be sure to include how blockchain is affecting the global economy and how you see it growing in the future.

           Prompt 2 “Big Data” (1-2 pages): Describe your understanding of big data and give an example of how you’ve seen big data used either personally or professionally. In your view, what demands is big data placing on organizations and data management technology?  How does big data affect a global economy? 

          Prompt 3 “Government and Policies” (1-2 pages):  Discuss the role government plays in a global economy.  Also, look at what policies are currently in place and then discuss what policies should be put in place. Conclude your paper with a detailed conclusion section. The paper needs to be approximately six to eight pages long, including both a title page and a references page (for a total of eight to ten pages). Be sure to use proper APA formatting and citations to avoid plagiarism. Your paper should meet these requirements: 

          • Be approximately six to eight pages in length, not including the required cover page and reference page.
          • Follow APA 7 guidelines. Your paper should include an introduction, a body with fully developed content, and a conclusion.
          • Support your answers with the readings from the course and at least two scholarly journal articles to support your positions, claims, and observations, in addition to your textbook. The school Library is a great place to find resources.
          • Be clearly and well-written, concise, and logical, using excellent grammar and style techniques. You are being graded in part on the quality of your writing.

          Research on the teaching plans on cancer. This plan will include the hospitalized AND discharged patient. Be sure to use the patient resources you found in the previous assignments such as support groups, include “usual” medications and treatments – physical therapy and of course home health or hospice. write in 300 words .put in a table form.need this in 14hours.

          Literature Review

          Forest fires are defined as a fire that spreads without control or planning, on vegetation either in rural or urban areas. Forest fires are the leading cause of forest destruction in the world. In forest fires, in addition to trees and bushes, animals, houses, natural shelters for some species are also lost, sometimes the soil is irreversibly damaged, and many harmful gases are emitted into the atmosphere. These gases produced by forest fires, added to others produced by the burning of fossil fuels, contribute to increasing the temperature of our planet. This article is aimed at determining the effects on global warming of these forest fires.

          Global warming is one more phenomenon within the process of climate change that humanity faces today. Global warming is nothing more than the increase in the temperature of the atmosphere and for that reason more heat is retained than necessary, and the Earth overheats. This process is undoubtedly the most worrying consequence of climate change that we are facing. The consequences of this phenomenon have influenced the seasons of the year, making the hot months longer and more intense and the winters shorter. To analyze how forest fires are directly related to these changes and vice versa, our review is directed (Figueiras, S,2022).

          Different studies show curious data about the relationship between global warming and forest fires. There are different opinions as to whether there is a reciprocal effect between both events. According to (Schauenberg, 2020) in 2019 there were 400 thousand more forest fires worldwide than in 2018. What is worse: more than three times as many hectares were burned in the same period. But this has an explanation: global warming increases the risk of fires in forested areas. Almost all the most devastating megafires in the last 10 years have occurred in unusually hot climates (UN Environment, 2020).

          Does this mean that the cause of forest fires is climate change? Strictly speaking, the answer is no. Climate change does not produce forest fires since these do not generate spontaneously because of a drought. Climate change affects the fact that year after year there is a greater amount of combustible material that can easily start to burn, but it is not the trigger of the fires (Castillo, et al. 2019). In this regard, much literature and experts say that 90% of forest fires are caused by humans. The causes known as natural usually refer to isolated events such as lightning strikes in Andean areas affected by drought, which constitute only 1% of the origin of these fires (González, et al. 2020).

          This research has analyzed various sources to determine the causes and effects of forest fires on global warming. It is important to consider all the opinions about it; Citizens must be aware of the risk and take extreme precautions. In fact, the ideal is to look for alternatives to the use of fire when we are in wooded environments. The genetic diversity of plants in forest areas should be cared for and stimulated. If there is an overabundance of trees, this will cause more virulent fires because fires spread more easily.

          References

          Castillo, M., Saavedra, Jorge., Brull, J. (2019). Fire severity in mega wildfires.

          Shauenberg, T. (January 9, 2020). Forest fires: climate change and deforestation increase the global risk.

          UN Environment. (January 10, 2020). Are big fires part of a new normal? www.unenvironment.org

          https://www.ceupe.mx) (Figueiras, S,2022)

          https://www.cne.go.cr/reduccion_riesgo/informacion.)

          González, M.E., Sapiains, R., Gómez-González, S., Garreaud, R., Miranda, A., Galleguillos, M., Jacques, M., Pauchard, A., Hoyos, J., Cordero, L. , Vásquez, F., Lara, A., Aldunce, P., Delgado, V., Arriagada, Ugarte, A.M., Sepúlveda, A., Farías, L., García, R., Rondanelli, R., J., Ponce, R., Vargas, F., Rojas, M., Boisier, J.P., C., Carrasco, Little, C., Osses, M., Zamorano, C., Díaz-Hormazábal, I., Ceballos, A. , Guerra, E., Moncada, M., Castillo, I. (2020). Forest fires in Chile: causes, impacts, and resilience. Climate and Resilience Science Center (CR)2, (ANID/FONDAP/15110009), 84 pp.

           Research: Circular Economy

          300 words to discuss the possible ways that we can practice the concept of ‘circular economy’ on your college on daily basis

          Chat With Support